IRESite record type: plasmid_with_promoter_and_putative_IRES_translationally_characterized
The shape of the nucleic acid molecule translated: linear
The quality of the mRNA/+RNA sequence: 3UTR_incomplete
The mRNA/+RNA description:
Putative bicistronic mRNA containing renilla and firefly luciferase genes with HCV IRES in the intercistronic
region without the chimeric intron. The sequence ends at its 3'-end right after the poly(A) signal from bovine
growth hormone (BGH) mRNA and thus the 3'-UTR might be slightly wrong (it is unknown what region of the BGH
signal was transcribed and where the poly(A) tail was added).
The mRNA/+RNA sequence represented in the +DNA notation:
Warning: mRNA sequence when devoid of trailing 'A's is still not a substring of the plasmid sequence. Is it because an intron is spliced out? Stay calm then. :-)
Credibility of mRNA sequence: reverse_engineered_sequence_and_should_match_experiment_except_3UTR
The abbreviated name of this ORF/gene: FLuc-fusion
The description of the protein encoded in this ORF: Firefly luciferase fused with 22 additional aminoacid residues (including the initiator ATG) from HCV
polyprotein at its N-terminus (ATGAGCACGAATCCTAAACCTCAAAGAAAAACCAAACGTAACACCAACCGCGGCCCACAGGACGTC). Please
note the point mutation from CCGCCG to CCGCGG to introduce the SacII site.
The translational frameshift (ribosome slippage) involved: 0
The ribosome read-through involved: no
The alternative forms of this protein occur by the alternative initiation of translation: not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents): 1545-3263
Remarks:
The donor vector of HCV IRES from S. Lemon / K. Honda (pRL-HL) contained 341 nt of HCV IRES (5'-UTR region
only) and 66 nt of the coding protein sequence (including the initiator ATG). This plasmid was point mutated
to contain SacII restriction site 19-14nt in front of the FLuc ORF (CCGCCG to CCGCGG).
The exact location of 3'-end of the in vivo transcript is unclear. The mRNA sequence used herein spans
from putative CMV transcription start site to the end of BGH poly(A) signal.
The IRES absolute position (the range includes START and STOP codons or their equivalents): 1204-1544
How IRES boundaries were determined: experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF: 79
3'-end of IRES relative to last base of the STOP codon of the upstream ORF: 419
5'-end of IRES relative to first base of the START codon of the downstream ORF: -341
3'-end of IRES relative to first base of the START codon of the downstream ORF: -1
The sequence of IRES region aligned to its secondary structure (if available):
Remarks:
As the IRES region we have annotated solely the 341 nts of HCV 5'-UTR. Thus, the 66 nt spacer between the
3'-end of IRES and the FLuc ORF is not annotated as IRES. Please note this region is translated and therefore
these 22 aminoacid residues encoded here are fused to the N-terminus of the FLuc protein. Despite the short
polyA tail the capped RNAs were found to be stable. The article does not discuss the more than 300 bases
spanning up to the XhoI site after the internal poly(A) tract.