The description of the protein encoded in this ORF: Firefly luciferase
The translational frameshift (ribosome slippage) involved: 0
The ribosome read-through involved: no
The alternative forms of this protein occur by the alternative initiation of translation: not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents): 1053-2705
Remarks:
It seems the pRF (Stoneley et al., 1998) plasmid has mostly been used for in vivo (please refer to
IRESiteID:184) assays. The first case we know of when a linearized pRF plasmid has been used for in
vitro studies is the work of Wang et al. (2005).
When IRESite curator tried to re-create the sequence in silico following up the procedure described in the
original article we ended up with a sequence lacking the SV40 enhancer. This was kindly brought up by K.
Spriggs and therefore we have inserted in 264bp long region into the resulting sequence:
TGAACGATGGAGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTT
TGAACGATGGAGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTC
TGAACGATGGAGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCT
GCCTGCTGGGGAGCCTGGGGACTTTCCACACCTGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCCTAACTGACA
CACATTCCACAGCGGATC