The description of the protein encoded in this ORF: Eukaryotic translation initiation factor 4 gamma, isoform II.
The translational frameshift (ribosome slippage) involved: 0
The ribosome read-through involved: no
The alternative forms of this protein occur by the alternative initiation of translation: not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents): 612-5369
Remarks:
This sequence encompasses the region studied by Johannes and Sarnow (1998) and named eIF4GII-long. The region
they studied as the 5'-UTR is located in this transcript between 288-614.
To assemble sequence of this entry curator IRESite extended at the 5'-end sequence of NM_003760.3 by 30 bp
long GGAGGCGGCCACAGCGCCATGTTGGATGCT sequence inferred from these ESTs: CN402456 DA260816. This record is
further supported by ESTs: DB451482, DB449034, CN402457, BU155832, BQ644097, DR002014, BF897694, BF897695.
An EST record with accession BD644097 is somewhat different inside the 5'-UTR region and could represent yet
another splice variant of eIF4GII.
Please note the RefSeq entry NM_003760 was not listed in the Supplementary Figure 12 of Baranick et al. (2008)
nor Byrd et al. (2005). That is probably because this gene is on chromosome 1 while their variants are from
chromosome 3.
Our extended mRNA sequence using ESTs in this entry spans in front of the genomic contig NC_000001:
>NC_000001 Homo sapiens chromosome 1, GRCh37 primary reference assembly.; LEN=370369
>IRESite_Id:574 eIF4GII-long (chromosome1); LEN=6205
1-126 (31-156) 100% -> (GT/AG) 24 (126bp exon)
490-673 (157-340) 100% -> (GT/AG) 24 (184bp exon)
87635-87710 (341-416) 100% -> (GT/AG) 24 (76bp exon)
125854-125982 (417-545) 100% -> (GT/AG) 24 (129bp exon)
>NT_004610 Homo sapiens chromosome 1 genomic contig, GRCh37 reference primary assembly.; LEN=16558170
>IRESite_Id:574 eIF4GII-long (chromosome1); LEN=6205
(complement)
[cut]
8057447-8057575 (5661-5789) 100% <- (GT/AG) 24 (129bp exon)
8095719-8095794 (5790-5865) 100% <- (GT/AG) 24 (76 bp exon)
8182756-8182939 (5866-6049) 100% <- (GT/AG) 24 (184bp exon)
8183303-8183458 (6050-6205) 100% (156bp exon)
The IRES absolute position (the range includes START and STOP codons or their equivalents): 288-614
Conclusion: never_claimed_to_be_IRES
How IRES boundaries were determined: experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):
Remarks:
Actually this region (325bp) was never claimed to harbor an IRES and has no IRES activity. In Figure 8 is
shown that eIF4GII-long performed badly in comparison with eIG4GI-ext and especially with PV IRES.