IRESite_Id:89 summary record describing characteristics of L-myc IRES

IRESite: The database of experimentally verified IRES structures

The nucleic acid data:

IRESite Id: `89`	Version: `7`
Originaly submitted by: Blanka Vicenová	Submission date: `2006-01-09 00:00:00`
Reviewed by: Martin Mokrejš	Last change: `2008-06-25 10:22:50`

IRESite record type:

natural_transcript

The shape of the nucleic acid molecule translated: `linear`	The quality of the mRNA/+RNA sequence: `our_best_guess`
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule: `L-myc`	The genetic origin of this natural mRNA/+RNA: `nuclear`

The GenBankId GI:# number of exactly this mRNA/+RNA sequence:
74315996

The mRNA/+RNA description:

Human L-myc protein gene, complete cds.

The mRNA/+RNA sequence represented in the +DNA notation:

aatgcgcctg cagctcgcgc tcccgcgccg atcccgagag cgtccgggcc gccgtgcgcg agcgagggag ggcgcgcgcg cggggggggc gcgcttgtga 
^1         ^11        ^21        ^31        ^41        ^51        ^61        ^71        ^81        ^91        

gtgcgggccg cgctctcggc ggcgcgcatg tgcgtgtgtg ctggctgccg ggctgccccg agccggcggg gagccggtcc gctccaggtg gcgggcggct 
^101       ^111       ^121       ^131       ^141       ^151       ^161       ^171       ^181       ^191       

ggagcgaggg agcggacatg gactacgact cgtaccagca ctatttctac gactatgact gcggggagga tttctaccgc tccacggcgc ccagcgagga 
^201       ^211       ^221       ^231       ^241       ^251       ^261       ^271       ^281       ^291       

catctggaag aaattcgagc tggtgccatc gccccccacg tcgccgccct ggggcttggg tcccggcgca ggggacccgg cccccgggat tggtcccccg 
^301       ^311       ^321       ^331       ^341       ^351       ^361       ^371       ^381       ^391       

gagccgtggc ccggagggtg caccggagac gaagcggaat cccggggcca ctcgaaaggc tggggcagga actacgcctc catcatacgc cgtgactgca 
^401       ^411       ^421       ^431       ^441       ^451       ^461       ^471       ^481       ^491       

tgtggagcgg cttctcggcc cgggaacggc tggagagagc tgtgagcgac cggctcgctc ctggcgcgcc ccgggggaac ccgcccaagg cgtccgccgc 
^501       ^511       ^521       ^531       ^541       ^551       ^561       ^571       ^581       ^591       

cccggactgc actcccagcc tcgaagccgg caacccggcg cccgccgccc cctgtccgct gggcgaaccc aagacccagg cctgctccgg gtccgagagc 
^601       ^611       ^621       ^631       ^641       ^651       ^661       ^671       ^681       ^691       

ccaagcgact cggagaatga agaaattgat gttgtgacag tagagaagag gcagtctctg ggtattcgga agccggtcac catcacggtg cgagcagacc 
^701       ^711       ^721       ^731       ^741       ^751       ^761       ^771       ^781       ^791       

ccctggatcc ctgcatgaag catttccaca tctccatcca tcagcaacag cacaactatg ctgcccgttt tcctccagaa agctgctccc aagaagaggc 
^801       ^811       ^821       ^831       ^841       ^851       ^861       ^871       ^881       ^891       

ttcagagagg ggtccccaag aagaggttct ggagagagat gctgcagggg aaaaggaaga tgaggaggat gaagagattg tgagtccccc acctgtagaa 
^901       ^911       ^921       ^931       ^941       ^951       ^961       ^971       ^981       ^991       

agtgaggctg cccagtcctg ccaccccaaa cctgtcagtt ctgatactga ggatgtgacc aagaggaaga atcacaactt cctggagcgc aagaggcgga 
^1001      ^1011      ^1021      ^1031      ^1041      ^1051      ^1061      ^1071      ^1081      ^1091      

atgacctgcg ttcgcgattc ttggcgctga gggaccaggt gcccaccctg gccagctgct ccaaggcccc caaagtagtg atcctaagca aggccttgga 
^1101      ^1111      ^1121      ^1131      ^1141      ^1151      ^1161      ^1171      ^1181      ^1191      

atacttgcaa gccctggtgg gggctgagaa gaggatggct acagagaaaa gacagctccg atgccggcag cagcagttgc agaaaagaat tgcatacctc 
^1201      ^1211      ^1221      ^1231      ^1241      ^1251      ^1261      ^1271      ^1281      ^1291      

actggctact aactgaccaa aaagcctgac agttctgtct tacgaagaca caagtttatt ttttaacctc cctctcccct ttagtaattt gcacattttg 
^1301      ^1311      ^1321      ^1331      ^1341      ^1351      ^1361      ^1371      ^1381      ^1391      

gttatggtgg gacagtctgg acagtagatc ccagaatgca ttgcagccgg tgcacacaca ataaaggctt gcattcttgg aaaccttgaa acccagctct 
^1401      ^1411      ^1421      ^1431      ^1441      ^1451      ^1461      ^1471      ^1481      ^1491      

ccctcttccc tgactcatgg gagtgctgta tgttctctgg cgcctttggc ttcccagcag gcagctgact gaggagcctt ggggtctgcc tagctcacta 
^1501      ^1511      ^1521      ^1531      ^1541      ^1551      ^1561      ^1571      ^1581      ^1591      

gctctgaaga aaaggctgac agatgctatg caacaggtgg tggatgttgt caggggctcc agcctgcatg aaatctcaca ctctgcatga gctttaggct 
^1601      ^1611      ^1621      ^1631      ^1641      ^1651      ^1661      ^1671      ^1681      ^1691      

aggaaaggat gctcccaact ggtgtctctg gggtgatgca aggacagctg ggcctggatg ctctccctga ggctcctttt tccagaagac acacgagctg 
^1701      ^1711      ^1721      ^1731      ^1741      ^1751      ^1761      ^1771      ^1781      ^1791      

tcttgggtga agacaagctt gcagacttga tcaacattga ccattacctc actgtcagac actttacagt agccaaggag ttggaaacct ttatatatta 
^1801      ^1811      ^1821      ^1831      ^1841      ^1851      ^1861      ^1871      ^1881      ^1891      

tgatgttagc tgaccccctt cctcccactc ccaatgctgc gaccctggga acacttaaaa agcttggcct ctagattctt tgtctcagag ccctctgggc 
^1901      ^1911      ^1921      ^1931      ^1941      ^1951      ^1961      ^1971      ^1981      ^1991      

tctctcctct gagggaggga cctttctttc ctcacaaggg acttttttgt tccattatgc cttgttatgc aatgggctct acagcaccct ttcccacagg 
^2001      ^2011      ^2021      ^2031      ^2041      ^2051      ^2061      ^2071      ^2081      ^2091      

tcagaaatat ttccccaaga cacagggaaa tcggtcctag cctggggcct ggggatagct tggagtcctg gcccatgaac ttgatccctg cccaggtgtt 
^2101      ^2111      ^2121      ^2131      ^2141      ^2151      ^2161      ^2171      ^2181      ^2191      

ttccgagggg cacttgaggc ccagtctttt ctcaaggcag gtgtaagaca cctcagaggg agaactgtac tgctgcctct ttcccacctg cctcatctca 
^2201      ^2211      ^2221      ^2231      ^2241      ^2251      ^2261      ^2271      ^2281      ^2291      

atccttgagc ggcaagtttg aagttcttct ggaaccatgc aaatctgtcc tcctcatgca attccaagga gcttgctggc tctgcagcca cccttgggcc 
^2301      ^2311      ^2321      ^2331      ^2341      ^2351      ^2361      ^2371      ^2381      ^2391      

ccttccagcc tgccatgaat cagatatctt tcccagaatc tgggcgtttc tgaagttttg gggagagctg ttgggactca tccagtgctc cagaaggtgg 
^2401      ^2411      ^2421      ^2431      ^2441      ^2451      ^2461      ^2471      ^2481      ^2491      

acttgcttct ggtgggtttt aaaggagcct ccaggagata tgcttagcca accatgatgg attttacccc agctggactc ggcagctcca agtggaatcc 
^2501      ^2511      ^2521      ^2531      ^2541      ^2551      ^2561      ^2571      ^2581      ^2591      

acgtgcagct tctagtctgg gaaagtcacc caacctagca gttgtcatgt gggtaacctc aggcacctct aagcctgtcc tggaagaagg accagcagcc 
^2601      ^2611      ^2621      ^2631      ^2641      ^2651      ^2661      ^2671      ^2681      ^2691      

cctccagaac tctgcccagg acagcaggtg cctgctggct ctgggtttgg aagttggggt gggtaggggg tggtaagtac tatatatggc tctggaaaac 
^2701      ^2711      ^2721      ^2731      ^2741      ^2751      ^2761      ^2771      ^2781      ^2791      

cagctgctac ttccaaatct attgtccata atggtttctt tctgaggttg cttcttggcc tcagaggacc ccaggggatg tttggaaata gcctctctac 
^2801      ^2811      ^2821      ^2831      ^2841      ^2851      ^2861      ^2871      ^2881      ^2891      

ccttctggag catggtttac aaaagccagc tgacttctgg aattgtctat ggaggacagt ttgggtgtag gttactgatg tctcaactga atagcttgtg 
^2901      ^2911      ^2921      ^2931      ^2941      ^2951      ^2961      ^2971      ^2981      ^2991      

ttttataagc tgctgttggc tattatgctg ggggagtctt ttttttttat attgtatttt tgtatgcctt ttgcaaagtg gtgttaactg tttttgtaca 
^3001      ^3011      ^3021      ^3031      ^3041      ^3051      ^3061      ^3071      ^3081      ^3091      

aggaaaaaaa ctcttggggc aatttcctgt tgcaagggtc tgatttattt tgaaaggcaa gttcacctga aattttgtat ttagttgtga ttactgattg 
^3101      ^3111      ^3121      ^3131      ^3141      ^3151      ^3161      ^3171      ^3181      ^3191      

cctgatttta aaatgttgcc ttctgggaca tcttctaata aaagatttct caaacatg
^3201      ^3211      ^3221      ^3231      ^3241      ^3251

Credibility of mRNA sequence:

unknown

The organism containing this mRNA with IRES segment in its genome:

Homo sapiens

A promoter reported in cDNA corresponding to IRES sequence:
not tested The total number of notable open-reading frames (ORFs):
1

Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:

ORF

ORF position:

1

Version: `0`
Originaly submitted by: Blanka Vicenová	Reviewed by: Martin Mokrejš

The abbreviated name of this ORF/gene:
L-myc

The description of the protein encoded in this ORF:
L-myc protein

The translational frameshift (ribosome slippage) involved:
0 The ribosome read-through involved:
no

The alternative forms of this protein occur by the alternative initiation of translation:

no

The ORF absolute position (the base range includes START and STOP codons or their equivalents):

218-1312

OPTIONAL: The function of the encoded protein

Short form of the L-myc protein; belongs to the myc family of proto-oncogenes; overexpression causes cellular
transformation.

Remarks:

There are two forms of L-myc that differ in their 5'UTR length (217b and 581b long) as a result of alternative
splicing (the longer form contains intron A, Fig. 1 in the article). IRES was found only in the short, spliced
form of L-myc mRNA. Integrity of bicistronic mRNA transcripts was verified by Northern blot analysis. From
Fig. 3B and 3C comes out that the L-myc IRES driven translation is more effective than cap-dependent
translation, which is highly unexpected. In contrast, dicistronic constructs containing the long form of the
5'-UTR in pRF (or derived from) plasmids resulted in heterogeneous population of mRNA -- possibly as a result
of splicing events of the intron within the L-myc long 5'-UTR.

Citations:

Jopling C. L., Spriggs K. A., Mitchell S. A., Stoneley M., Willis A. E. (2004) L-Myc protein synthesis is initiated by internal ribosome entry. RNA. 10(2):287-298

IRESs:

IRES:

Version: `4`	Last change: `2008-06-25 10:22:50`
Originaly submitted by: Blanka Vicenová	Reviewed by: Martin Mokrejš
The IRES name: `L-myc`

The IRES absolute position (the range includes START and STOP codons or their equivalents):

90-141

Conclusion:
putative_IRES

How IRES boundaries were determined:
experimentally_determined

The sequence of IRES region aligned to its secondary structure (if available):

cgcgcttgtg agtgcgggcc gcgctctcgg cggcgcgcat gtgcgtgtgt gc
(((((((((. ...))))).) )))))).((( (((((((((( (....))))) ))
^90        ^100       ^110       ^120       ^130       ^140

There is no Vienna RNA package installed on the server or some error/warning messages were output. Due to that maybe we cannot prepare 2D structures for display. The error/warning message was:

(((((((((....))))).))))))).((((((((((((((....)))))))
ERROR: unbalanced brackets in make_pair_table

STDOUT was:

Remarks:

Concerning the absolute IRES localization no further positional data available; according to Jopling et al.,
2004, the ribosome entry site is located between positions 90 and 141.

Citations:

Jopling C. L., Spriggs K. A., Mitchell S. A., Stoneley M., Willis A. E. (2004) L-Myc protein synthesis is initiated by internal ribosome entry. RNA. 10(2):287-298

Regions with experimentally determined secondary structures:

A region with the experimentally determined secondary structure:

IRESite 2D Struct Id: 7

Version: `6`	Last change: `2006-04-10 00:00:00`
Originaly submitted by: Blanka Vicenová	Reviewed by: Martin Mokrejš
The function of the 2D structure: `IRES`	The 2D structure causes frameshift: `unknown`

The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents):
1-217

The underlying nucleic acid sequence and structure of the mapped region:

aatgcgcctg cagctcgcgc tcccgcgccg atcccgagag cgtccgggcc gccgtgcgcg agcgagggag ggcgcgcgcg cggggggggc gcgcttgtga 
......((.( (((((((((( ....)))).. .......))) )))).)).(( .((((((((( .((....... .)).)))))) ))))).(((( ((((((((.. 
^1         ^11        ^21        ^31        ^41        ^51        ^61        ^71        ^81        ^91        

gtgcgggccg cgctctcggc ggcgcgcatg tgcgtgtgtg ctggctgccg ggctgccccg agccggcggg gagccggtcc gctccaggtg gcgggcggct 
..))))).)) ))))).(((( (((((((((( ....)))))) )..))))))) ..(((((((. .((((((... ..)))))).( (((((((.(( .....)).)) 
^101       ^111       ^121       ^131       ^141       ^151       ^161       ^171       ^181       ^191       

ggagcgaggg agcggac
)))))).))) .))))..
^201       ^211

There is no Vienna RNA package installed on the server or some error/warning messages were output. Due to that maybe we cannot prepare 2D structures for display. The error/warning message was:

WARNING: bases 11 and 43 (CU) can't pair!
WARNING: bases 12 and 42 (AG) can't pair!

STDOUT was:

aaugcgccugcagcucgcgcucccgcgccgaucccgagagcguccgggccgccgugcgcgagcgagggagggcgcgcgcgcggggggggcgcgcuugugagugcgggccgcgcucucggcggcgcgcaugugcgugugugcuggcugccgggcugccccgagccggcggggagccgguccgcuccagguggcgggcggcuggagcgagggagcggac
......((.(((((((((((....)))).........))))))).)).((.(((((((((.((........)).))))))))))).((((((((((((....))))).))))))).((((((((((((((....)))))))..)))))))..(((((((..((((((.....)))))).((((((((.((.....)).)))))))).))).)))).. (-116.00)

Rendering structure of L-myc mRNA 217 nt long with energy of -116.00 kcal/mol as calculated by RNAeval using VARNA Java applet with some IRESite improvements (see VARNA modified by IRESite). Hold left mouse button to move structure parts, hold right mouse button to move whole structure, use mouse wheel to zoom. Right mouse-click opens a menu to export into JPG/SVG and many other options.

You need a Java-enabled browser so that modified varsion of VARNA could be started. See http://www.iresite.org/VARNA/ for more details.

Remarks:

L-myc IRES RNA was generated using in vitro transcription reactions, resuspended in probing buffer, and then
heated rapidly and cooled gradually to refold the molecule into its native conformation (Le Quesne et al.
2001). RNA was treated either with DMS / kethoxal / CMCT to detect unpaired bases. RNase V1 was used to detect
basepaired regions. Secondary structure was predicted using the web implementation of the Mfold algorithm
(Zuker et al., 1999) with the experimental data used as the prediction contraints. There is a potential
pseudoknot between 32-35 and 66-69. The degree of concordance of the chemical probing data with the final
secondary structure model was not specified.

3.1.1. Enzymes used to characterize at least partially the 2D structure.

Enzyme or a combination of enzymes used in a single experiment with respective buffer:

ss_experiment_with_enzyme_id: 7

The temperature (in degrees of Celsia):
0 The enzymatic method used to determine the 2D structure:
ribonuclease V1

Enzyme or a combination of enzymes used in a single experiment with respective buffer:

Version: 0

pH `7.00`	Li⁺ [mM] `0`	Na⁺ [mM] `0`	K⁺ [mM] `0.10`	Mg²⁺ [mM] `10.00`	Ca²⁺ [mM] `0`
Cl^- [mM] `0.12`	Tris [mM] `10.00`	BSA [mM] `0`	HEPES [mM] `0`	EGTA [mM] `0`	EDTA [mM] `0`
cacodylate [mM] `0`

3.1.2. Chemicals used to characterize at least partially the 2D structure.