The IRES absolute position (the range includes START and STOP codons or their equivalents): 814-1400
How IRES boundaries were determined: experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF: 85
3'-end of IRES relative to last base of the STOP codon of the upstream ORF: 671
5'-end of IRES relative to first base of the START codon of the downstream ORF: -629
3'-end of IRES relative to first base of the START codon of the downstream ORF: -43
The sequence of IRES region aligned to its secondary structure (if available):
Remarks:
There are some differences to the reference EMCV-R strain IRES (Query is the IRES region tagged in this
IRESite entry sequence):
Query: 481 acatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggg 540
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 741 acatgctttacatgtgtttagtcgaggtt-aaaaaacgtctaggccccccgaaccacggg 799
Query: 541 gacgtggttttcctttgaaaaacacgatgataagct-t-gccacaacc 586
||||||||||||||||||||||||||||||||| | | |||||||||
Sbjct: 800 gacgtggttttcctttgaaaaacacgatgataa--tatggccacaacc 845