IRESite record type: plasmid_with_promoter_and_putative_IRES_without_translational_characterization
The shape of the nucleic acid molecule translated: linear
The quality of the mRNA/+RNA sequence: both_UTRs_possibly_incomplete
The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one. 104744492
The mRNA/+RNA description:
One of the two putative in vivo transcripts of mammalian expression vector pCBio: this one is from minimal CMV
promoter down to beta-globin poly(A) signal from rabbit.
The mRNA/+RNA sequence represented in the +DNA notation:
Credibility of mRNA sequence: reverse_engineered_sequence_and_should_match_experiment_except_both_UTRs
The IRES absolute position (the range includes START and STOP codons or their equivalents): 221-807
How IRES boundaries were determined: experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):
Remarks:
There are some differences in sequence of the IRES region tagged in this entry compared to the reference
EMCV-R IRES:
Query: 481 cacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacgg 540
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 740 cacatgctttacatgtgtttagtcgaggtt-aaaaaacgtctaggccccccgaaccacgg 798
Query: 541 ggacgtggttttcctttgaaaaacacgatgataagct-t-gccacaacc 587
|||||||||||||||||||||||||||||||||| | | |||||||||
Sbjct: 799 ggacgtggttttcctttgaaaaacacgatgataa--tatggccacaacc 845
Last change to the database: 2019-03-18 09:32:49 GMT+1