The nucleic acid data:
IRESite Id: 107 Version: 7
Originaly submitted by: Martin Mokrejš Submission date: 2005-12-22 00:00:00
Reviewed by: Martin Mokrejš Last change: 2009-04-15 13:10:04
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  our_best_guess
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  ODC1
The genetic origin of this natural mRNA/+RNA:
  nuclear
The GenBankId GI:# number of exactly this mRNA/+RNA sequence:
205803
The mRNA/+RNA description: 
Rat ornithine decarboxylase (ODC) mRNA, complete cds.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  reverse_engineered_fragment_and_the_rest_is_a_guess
The organism containing this mRNA with IRES segment in its genome:
Rattus norvegicus AR4-2J
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The total number of notable open-reading frames (ORFs):
  1
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 2 Last change: 2009-04-15 13:10:04
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
ODC1
The description of the protein encoded in this ORF:
ornithine decarboxylase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  304-1689
Remarks:
The GI:205803 mRNA sequence from rat (2442b) contains 1-423 5'-UTR and 1810-2442b 3'-UTR and aligns well to
the sequence available in IRESdb which acquired the sequence directly from S. Pyronnet. However, the 5'-UTR
sequence matching in GenBank (and used by IRESite since position 121) is longer by 120 bp on the left (only
the overlap shown below):

>gb|M16982.1|RATODC UniGene infoGeoGene info Rat ornithine decarboxylase (ODC) mRNA, complete cds
Length=2442

 GENE ID: 24609 Odc1 | ornithine decarboxylase 1 [Rattus norvegicus]
(Over 10 PubMed links)

 Score =  558 bits (302),  Expect = 7e-159
 Identities = 305/306 (99%), Gaps = 1/306 (0%)
 Strand=Plus/Plus

Query  1    GTCAGTCCCTGCAGCCGCCGCCGCCGGCCGCCTTCAGTCAGCAGCTcggcgccacctccg  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  121  GTCAGTCCCTGCAGCCGCCGCCGCCGGCCGCCTTCAGTCAGCAGCTCGGCGCCACCTCCG  180

Query  61   gtcggcgactgcggcgggctcgacgaggcggctgacggggcggcggcgggaagacggccg  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  181  GTCGGCGACTGCGGCGGGCTCGACGAGGCGGCTGACGGGGCGGCGGCGGGAAGACGGCCG  240

Query  121  ggTGCGCCTTGGGGTTTAGTGGCGGCTTCTCCATGGGTCCAGCCAGCCGCTTCCCTGTGC  180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  241  GGTGCGCCTTGGGGTTTAGTGGCGGCTTCTCCATGGGTCCAGCCAGCCGCTTCCCTGTGC  300

Query  181  TGTGAGTGTTTCCACCACTCCAGGAGACAG-ATTCAGAGTTGACCTTGTGAGAGCTGGCC  239
            |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct  301  TGTGAGTGTTTCCACCACTCCAGGAGACAGCATTCAGAGTTGACCTTGTGAGAGCTGGCC  360

Query  240  ATAATTTAATTCCATCTCTAGGTTTTCTGTCTTATTGTTTCAGAGGCACATCGAGAACCA  299
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  361  ATAATTTAATTCCATCTCTAGGTTTTCTGTCTTATTGTTTCAGAGGCACATCGAGAACCA  420

Query  300  ACCATG  305
            ||||||
Sbjct  421  ACCATG  426


A BLAST-based search for ESTs using the GI:205803 rat sequence results in no EST sequence covering completely
the 5'-UTR region. Instead, introns are seen in various positions. It seems the transcription start site is
at the best at position 120 if not downstream. Therefore, the RefSeq record is probably an over-prediction.


The best EST match in terms of sequence identity is:

>gb|CK469804.1| AGENCOURT_17644639 NIH_MGC_237 Rattus norvegicus cDNA clone IMAGE:7113571 5', mRNA sequence.
Length=828

 Score =  558 bits (302),  Expect = 1e-157
 Identities = 302/302 (100%), Gaps = 0/302 (0%)
 Strand=Plus/Plus

Query  122  TCAGTCCCTGCAGCCGCCGCCGCCGGCCGCCTTCAGTCAGCAGCTcggcgccacctccgg  181
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1    TCAGTCCCTGCAGCCGCCGCCGCCGGCCGCCTTCAGTCAGCAGCTCGGCGCCACCTCCGG  60

Query  182  tcggcgactgcggcgggctcgacgaggcggctgacggggcggcggcgggaagacggccgg  241
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  61   TCGGCGACTGCGGCGGGCTCGACGAGGCGGCTGACGGGGCGGCGGCGGGAAGACGGCCGG  120

Query  242  gTGCGCCTTGGGGTTTAGTGGCGGCTTCTCCATGGGTCCAGCCAGCCGCTTCCCTGTGCT  301
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  121  GTGCGCCTTGGGGTTTAGTGGCGGCTTCTCCATGGGTCCAGCCAGCCGCTTCCCTGTGCT  180

Query  302  GTGAGTGTTTCCACCACTCCAGGAGACAGCATTCAGAGTTGACCTTGTGAGAGCTGGCCA  361
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  181  GTGAGTGTTTCCACCACTCCAGGAGACAGCATTCAGAGTTGACCTTGTGAGAGCTGGCCA  240

Query  362  TAATTTAATTCCATCTCTAGGTTTTCTGTCTTATTGTTTCAGAGGCACATCGAGAACCAA  421
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  241  TAATTTAATTCCATCTCTAGGTTTTCTGTCTTATTGTTTCAGAGGCACATCGAGAACCAA  300

Query  422  CC  423
            ||
Sbjct  301  CC  302


There are several other GenBank records covering ODC1 in human but lets say two should be considered more
seriously. The GI:19263695 (2039 b, 29-JUN-2004, 5'-UTR 1-301, 3'-UTR 1688-2039) and GI:33869436 (2043 b,
24-JUN-2004, 5'-UTR 1-484, 3'-UTR 1676-2043). Pyronnet et al., 2000 refer to ODC1 from Rattus norvegicus
having 303b long 5'-UTR. Multiple sequence alignment shows human GI:35135 (2035 b, 18-MAR-1996, 5'-UTR
1-302, 3'-UTR 1689-2035) and GI:19263695 are very similar except about 5 mismatches while one removes an
upstream ATG codon.


Pyronnet et al., Gastroentrology 108(4):xx-xx reported a 53bp shorter variant of ODC1 transcript amplified
by RT-PCR compared to full-legth variant of rat caused by alternative splicing with splice sites moved inwards
of exon1 while both splice donor and acceptor sites appeared in a direct repeat heptanucleotide GGCGGCU and
that the motif was reconstituted in the spliced product. The shorter variant was found to be 3x more
translated than the full-length transcript in which 5'-end 130bp were reported to contain strong secondary
structure.

The ODC1 IRES sequence present in BCCM plasmid repository (not sequence, only guessed based on some GenBank
record) is different. See http://bccm.belspo.be/db/lmbp_plasmid_details.php?NM=pcDNA3-di-RF-ODC for more
details.
Citations:
Pyronnet S., Pradayrol L., Sonenberg N. (2000) A cell cycle-dependent internal ribosome entry site. Mol. Cell. 5(4):607-616
Pyronnet S., Pradayrol L., Sonenberg N. (2005) Alternative splicing facilitates internal ribosome entry on the ornithine decarboxylase mRNA. Cell. Mol. Life Sci. 62(11):1267-1274
IRESs:
IRES:
Version: 5 Last change: 2009-04-15 13:10:04
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  ODC1
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1-303
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
Bicistronic constructs studied by Pyronnet et al., 2000 were tested by in vitro translation in rabbit
reticulocytes (optionally treated with rhinoviral 2A protease) and in transiently transfected cells. Integrity
of bicistronic transcripts used in rabbit reticulocyte lysates was tested by Northern blot. IRES activity is
impaired when UUUC segment is mutated to AAAC (authors mutated the one about 20b upstream from translation
start). But, there are more such short stretches in the 5'-UTR of ODC1.
Citations:
Pyronnet S., Pradayrol L., Sonenberg N. (2000) A cell cycle-dependent internal ribosome entry site. Mol. Cell. 5(4):607-616
Pyronnet S., Pradayrol L., Sonenberg N. (2005) Alternative splicing facilitates internal ribosome entry on the ornithine decarboxylase mRNA. Cell. Mol. Life Sci. 62(11):1267-1274
Last change to the database: 2015-04-16 16:45:23 GMT+1