The nucleic acid data:
IRESite Id: 113 Version: 6
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2006-07-26 00:00:00
IRESite record type:
  plasmid_with_promoter_and_putative_IRES_without_translational_characterization
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  hopefully_full-length_mRNA
The mRNA/+RNA description: 
Bicistronic T7 capped mRNA transcript used for in vitro translation (with short synthetic polyA tail (35nt
only)). It includes stable RNA hairpin deltaG = -60 kcal/mol inserted at unique NheI immediately upstream
RLuc.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_completely_same_as_in_the_experiment
The name of the plasmid:
phpRL-BCL2-FL-polyA
The name of the promoter used to express this mRNA:
  T7
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
BCL2
The origin of IRES in the plasmid:
  nuclear
The donor organism of the IRES segment:
Homo sapiens HeLa (ATCC CCL-2)
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
phpRL-BCL2-FL-polyA.jpg
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
RLuc
The description of the protein encoded in this ORF:
renilla luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  154-1089
ORF
ORF position:   2
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
FLuc-fusion
The description of the protein encoded in this ORF:
Firefly luciferase fused with 6 additional aminoacids from BCL2 ORF.
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  2243-3913
Remarks:
Annotation of the plasmid: 16-812: CMV immediate early enhancer/promoter; 751: CMV transcription start;
869-1005: chimeric intron; 1049-1067: T7 RNA polymerase promoter (-17 - +2); 1066: T7 promoter transcription
start (+1); 1219-2154: RLUc; 2170-3307: BCL2 5'-UTR; 3308-4978: FFluc-fusion protein ORF

Here is the difference between the two plasmids. phpRL-BCL2-FL-polyA contains the hairpin structure.

phpRL-BCL2-FL-polyA      CAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACTCACTATAGGCTAGCATTCTGTC
pRL-BCL2-FL-polyA        CAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACTCACTATAGGCTAGC--------
                         ****************************************************

phpRL-BCL2-FL-polyA      TGTTTTGGGGGATTGCAAGTAAAGATAGGATCCGGGGCGCGTGGTGGCGGCTGCAGCCGC
pRL-BCL2-FL-polyA        ------------------------------------------------------------


phpRL-BCL2-FL-polyA      CACCACGCGCCCCAAGCTTATCTCAAAAGCAAGTGTAAGCAGCAGCGCCGCAGCCACTGC
pRL-BCL2-FL-polyA        ------------------------------------------------------------


phpRL-BCL2-FL-polyA      TTTTATAAGCTAGCCACCATGACTTCGAAAGTTTATGATCCAGAACAAAGGAAACGGATG
pRL-BCL2-FL-polyA        --------------CACCATGACTTCGAAAGTTTATGATCCAGAACAAAGGAAACGGATG
                                       **********************************************
Citations:
Sherrill K. W., Byrd M. P., Van Eden M. E., Lloyd R. E. (2004) BCL-2 translation is mediated via internal ribosome entry during cell stress. J. Biol. Chem. 279(28):29066-29074
IRESs:
IRES:
Version: 4 Last change: 2006-10-30 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  BCL2
The functional status of IRES:
  functional
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1105-2242
How IRES boundaries were determined:
experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  16
3'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  1153
5'-end of IRES relative to first base of the START codon of the downstream ORF:
  -1138
3'-end of IRES relative to first base of the START codon of the downstream ORF:
  -1
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
IRES activity as shown in Fig. 2. in this construct cannot be interpreted as there was no correct positive nor
negative control. In vitro transcripts were produced using T7 polymerase in presence of m7G cap analog at
ratio of 4:1 versus rGTP and equimolar amounts of RNA were subject to translation in RRL. RNAs had short
(35nt) long polyA tail. The yields from the first cistron were not equal although all transcripts were capped
and 5'-UTRs had same length. One of the possible explanations might be that different efficiencies of capping
account for this. One could have few concerns: 1) a plasmid phpRL-FL should have been employed as the negative
control. Unfortunately, such plasmid was not even constructed. 2) Similarly, no phpRL-HCV-FL was
employed&constructed as the tempting positive control. Thus, the only conclusion is that the hairpin structure
(-60 kcal/mol, 143 bp insert size containing the hairpin while we did not verify (using mfold) whether the
actual hairpin spans the whole region or only its part) decreases translation from the first cistron by 98%
and that lowering cap-dependent initiation also results in lower IRES-dependent yields from the second
cistron. The hairpin insert is separated by 4 nt from the initiator ATG of RLuc.
Citations:
Sherrill K. W., Byrd M. P., Van Eden M. E., Lloyd R. E. (2004) BCL-2 translation is mediated via internal ribosome entry during cell stress. J. Biol. Chem. 279(28):29066-29074
Last change to the database: 2015-04-16 16:45:23 GMT+1