The nucleic acid data:
IRESite Id: 116 Version: 5
Originaly submitted by: Tomáš Mašek
Reviewed by: Tomáš Mašek Last change: 2009-08-30 21:10:19
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  3UTR_incomplete
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  HAP4
The genetic origin of this natural mRNA/+RNA:
  nuclear
The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one.
486182 
Synonyms of the gene name:
Synonym: YKL109W
The mRNA/+RNA description: 
mRNA encoding a transcriptional activator and global regulator of respiratory gene expression.
The mRNA sequence is inserted without 3'UTR region, the 272 bp long 5'-UTR corresponds to the shortest
identified transcript of HAP4 gene.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  reverse_engineered_fragment_and_the_rest_is_a_guess
The organism containing this mRNA with IRES segment in its genome:
Saccharomyces cerevisiae
A promoter reported in cDNA corresponding to IRES sequence:
  yes
The total number of notable open-reading frames (ORFs):
  1
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
not_tested
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
unclear_result
Integrity (uniformity) of mRNA tested using RT-PCR:
homogeneous_population_of_molecules_confirmed
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
promoter_confirmed
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
promoter_confirmed
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Saccharomyces cerevisiae
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 2 Last change: 2009-08-30 21:10:19
Originaly submitted by: Tomáš Mašek Reviewed by: Tomáš Mašek
The abbreviated name of this ORF/gene:
Hap4p
The description of the protein encoded in this ORF:
Subunit of the heme-activated, glucose-repressed Hap2p/3p/4p/5p CCAAT-binding complex, a transcriptional activator and global regulator of respiratory gene expression; provides the principal activation function of the complex.
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  280-1944
Remarks:
Our mRNA sequence could be extended by ACCTCTC on its 5'-end to match the shortest full-length cDNA clone
(S03052-13_H21) as shown in SGD database in region chrXI:229155..236250
(http://db.yeastgenome.org/cgi-bin/locus.pl?locus=HAP4 and go for GBrowse). The primers used by Seino et al.
(2005) to copy the 5'-UTR region amplified only 270 bases and the cDNA region ended 2 nucleotides in front of
the initiator AUG:

iresite                                   -------TAAACCCCAGTTTTATATCGTATATGCTATCTACAGGTCCACTTTACACTTAA
second_primer_without_BamHI               ------------------------------------------------------------
S03052-13_H21                             ACCTCTCTAAACCCCAGTTTTATATCGTATATGCTATCTACAGGTCCACTTTACACTTAA
first_primer_inverted_without_EcoRI_SmaI  ------------------------------------------------------------


iresite                                   TAATATAAAAATACTACTATAAAGGAACCAGAAAAATAAAAAAGGGTCATTATTTATTTG
second_primer_without_BamHI               ------------------------------------------------------------
S03052-13_H21                             TAATATAAAAATACTACTATAAAGGAACCAGAAAAATAAAAAAGGGTCATTATTTATTTG
first_primer_inverted_without_EcoRI_SmaI  ------------------------------------------------------------


iresite                                   AGCAGATCATTATCAAACGCATAGGAAGAGAAAAAACACAGTTTTATTTTTTTTCCACAC
second_primer_without_BamHI               ------------------------------------------------------------
S03052-13_H21                             AGCAGATCATTATCAAACGCATAGGAAGAGAAAAAACACAGTTTTATTTTTTTTCCACAC
first_primer_inverted_without_EcoRI_SmaI  ------------------------------------------------------------


iresite                                   ATATTTATTGGTCTCCTAGTACATCAAAGAGCATTTTAATGGGTTGCTGATTTGTTTTAC
second_primer_without_BamHI               ------------------------------------------------------------
S03052-13_H21                             ATATTTATTGGTCTCCTAGTACATCAAAGAGCATTTTAATGGGTTGCTGATTTGTTTTAC
first_primer_inverted_without_EcoRI_SmaI  ------------------------------------------------------------


iresite                                   CTACATTTTCTAGTACAAAAAAAAAACAAAAAAAGAATCATGACCGCAAAGACTTTTCTA
second_primer_without_BamHI               ------------------------------------------------------------
S03052-13_H21                             CTACATTTTCTAGTACAAAAAAAAAACAAAAAAAGAATCATGACCGCAAAGACTTTTCTA
first_primer_inverted_without_EcoRI_SmaI  ------------GTACAAAAAAAAAACAAAAAAAGAA-----------------------
Citations:
Forsburg S. L., Guarente L. (1989) Identification and characterization of HAP4: a third component of the CCAAT-bound HAP2/HAP3 heteromer. Genes Dev. 3(8):1166-1178
IRESs:
IRES:
Version: 8 Last change: 2007-09-06 00:00:00
Originaly submitted by: Tomáš Mašek Reviewed by: Tomáš Mašek
The IRES name:
  HAP4
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  8-277
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
Seino (2005) confirmed observation of Iizuka et al. 1994 that hap4 5'-UTR is translated in yeast cell lysates
in the presence of cap analogs. Further, Seino proposed cap-independent translation of HAP4 mRNA in stationary
phase in living yeast cells. On the contrary, Hecht (2002) reported that 5'-UTR of HAP4 is capable to drive
expression of promoter-less GFP construct and that this expression is induced in the presence of raffinose or
galactose but not in the presence of glucose.
Citations:
Seino A., Yanagida Y., Aizawa M., Kobatake E. (2005) Translational control by internal ribosome entry site in Saccharomyces cerevisiae. Biochim. Biophys. Acta. 1681(2-3):166-174
Hecht K., Bailey J. E., Minas W. (2002) Polycistronic gene expression in yeast versus cryptic promoter elements. FEMS Yeast. Res. 2(2):215-224
Iizuka N., Najita L., Franzusoff A., Sarnow P. (1994) Cap-dependent and cap-independent translation by internal initiation of mRNAs in cell extracts prepared from Saccharomyces cerevisiae. Mol. Cell. Biol. 14(11):7322-7330
Last change to the database: 2015-04-16 16:45:23 GMT+1