The nucleic acid data:
IRESite Id: 131 Version: 8
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2009-07-16 18:05:13
IRESite record type:
  plasmid_with_promoter_and_putative_IRES_translationally_characterized
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  3UTR_incomplete
The mRNA/+RNA description: 
Putative bicistronic mRNA containing renilla and firefly luciferase genes with HCV IRES in the intercistronic
region without the chimeric intron. The sequence ends at its 3'-end right after the poly(A) signal from bovine
growth hormone (BGH) mRNA and thus the 3'-UTR might be slightly wrong (it is unknown what region of the BGH
signal was transcribed and where the poly(A) tail was added).
The mRNA/+RNA sequence represented in the +DNA notation:


Warning: mRNA sequence when devoid of trailing 'A's is still not a substring of the plasmid sequence. Is it because an intron is spliced out? Stay calm then. :-)
Credibility of mRNA sequence:
  reverse_engineered_sequence_and_should_match_experiment_except_3UTR
The name of the plasmid:
pRL-HCV-FL
The name of the promoter used to express this mRNA:
  CMV
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
HCV_type_1b
The origin of IRES in the plasmid:
  viral
The donor organism of the IRES segment:
Hepatitis C virus type 1b
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pRL-HCV-FL.jpg
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 1 Last change: 2006-10-30 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
RLuc
The description of the protein encoded in this ORF:
Renilla luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  190-1125
ORF
ORF position:   2
Version: 3 Last change: 2007-01-24 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
FLuc-fusion
The description of the protein encoded in this ORF:
Firefly luciferase fused with 22 additional aminoacid residues (including the initiator ATG) from HCV polyprotein at its N-terminus (ATGAGCACGAATCCTAAACCTCAAAGAAAAACCAAACGTAACACCAACCGCGGCCCACAGGACGTC). Please note the point mutation from CCGCCG to CCGCGG to introduce the SacII site.
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1545-3263
Remarks:
The donor vector of HCV IRES from S. Lemon / K. Honda (pRL-HL) contained 341 nt of HCV IRES (5'-UTR region
only) and 66 nt of the coding protein sequence (including the initiator ATG). This plasmid was point mutated
to contain SacII restriction site 19-14nt in front of the FLuc ORF (CCGCCG to CCGCGG).

The exact location of 3'-end of the in vivo transcript is unclear. The mRNA sequence used herein spans
from putative CMV transcription start site to the end of BGH poly(A) signal.
Citations:
Sherrill K. W., Byrd M. P., Van Eden M. E., Lloyd R. E. (2004) BCL-2 translation is mediated via internal ribosome entry during cell stress. J. Biol. Chem. 279(28):29066-29074
IRESs:
IRES:
Version: 4 Last change: 2006-10-31 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  HCV_type_1b
The functional status of IRES:
  functional
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1204-1544
How IRES boundaries were determined:
experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  79
3'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  419
5'-end of IRES relative to first base of the START codon of the downstream ORF:
  -341
3'-end of IRES relative to first base of the START codon of the downstream ORF:
  -1
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
As the IRES region we have annotated solely the 341 nts of HCV 5'-UTR. Thus, the 66 nt spacer between the
3'-end of IRES and the FLuc ORF is not annotated as IRES. Please note this region is translated and therefore
these 22 aminoacid residues encoded here are fused to the N-terminus of the FLuc protein. Despite the short
polyA tail the capped RNAs were found to be stable. The article does not discuss the more than 300 bases
spanning up to the XhoI site after the internal poly(A) tract.
Citations:
Sherrill K. W., Byrd M. P., Van Eden M. E., Lloyd R. E. (2004) BCL-2 translation is mediated via internal ribosome entry during cell stress. J. Biol. Chem. 279(28):29066-29074
The translation experiments:
Translation results:
IRESite Translation Id: 94
Version: 1 Last change: 2007-01-24 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The translation method used to study IRES function:
in vivo
The organism used for translation:
Homo sapiens HEK 293T/17 (ATCC CRL-11268)
The temperature (in degrees of Celsia):
37
The relative translation efficiency in % of this IRES:
  100.000
Name of the plasmid used as the negative control.
pRL-FL
IRESite Id of the plasmid used as negative control.
  119
The relative translation efficiency in % of the negative control:
  2.000
The size (length) of intercistronic region in the negative control:
28
The effect of 5'-cap analogs on translation:
not tested
Rapamycin affects translation:
not tested
Type of RNA subject to translation:
  endogenous_nuclear_RNA_Pol_II_transcript
Remarks:
Fig. 3A.
Citations:
Sherrill K. W., Byrd M. P., Van Eden M. E., Lloyd R. E. (2004) BCL-2 translation is mediated via internal ribosome entry during cell stress. J. Biol. Chem. 279(28):29066-29074
Translation results:
IRESite Translation Id: 325
Version: 1 Last change: 2007-01-24 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The translation method used to study IRES function:
in vivo
The organism used for translation:
Homo sapiens HEK 293T/17 (ATCC CRL-11268)
The temperature (in degrees of Celsia):
37
The relative translation efficiency in % of this IRES:
  100.000
Name of the plasmid used as the negative control.
pRL-FL
IRESite Id of the plasmid used as negative control.
  119
The relative translation efficiency in % of the negative control:
  52.000
The size (length) of intercistronic region in the negative control:
28
The effect of 5'-cap analogs on translation:
not tested
Rapamycin affects translation:
not tested
Type of RNA subject to translation:
  endogenous_nuclear_RNA_Pol_II_transcript
Remarks:
Fig. 1.
Citations:
Van Eden M. E., Byrd M. P., Sherrill K. W., Lloyd R. E. (2004) Demonstrating internal ribosome entry sites in eukaryotic mRNAs using stringent RNA test procedures. RNA. 10(4):720-730
Translation results:
IRESite Translation Id: 326
Version: 1 Last change: 2007-01-24 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The translation method used to study IRES function:
in vivo
The organism used for translation:
Homo sapiens HeLa S3 (ATCC CCL-2.2)
The temperature (in degrees of Celsia):
37
The relative translation efficiency in % of this IRES:
  100.000
Name of the plasmid used as the negative control.
pRL-FL
IRESite Id of the plasmid used as negative control.
  119
The relative translation efficiency in % of the negative control:
  60.000
The size (length) of intercistronic region in the negative control:
28
The effect of 5'-cap analogs on translation:
not tested
Rapamycin affects translation:
not tested
Type of RNA subject to translation:
  endogenous_nuclear_RNA_Pol_II_transcript
Remarks:
Fig. 1.
Citations:
Van Eden M. E., Byrd M. P., Sherrill K. W., Lloyd R. E. (2004) Demonstrating internal ribosome entry sites in eukaryotic mRNAs using stringent RNA test procedures. RNA. 10(4):720-730
Translation results:
IRESite Translation Id: 327
Version: 1 Last change: 2007-01-24 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The translation method used to study IRES function:
in vivo
The organism used for translation:
Homo sapiens HepG2 (ATCC HB-8065)
The temperature (in degrees of Celsia):
37
The relative translation efficiency in % of this IRES:
  100.000
Name of the plasmid used as the negative control.
pRL-FL
IRESite Id of the plasmid used as negative control.
  119
The relative translation efficiency in % of the negative control:
  52.000
The size (length) of intercistronic region in the negative control:
28
The effect of 5'-cap analogs on translation:
not tested
Rapamycin affects translation:
not tested
Type of RNA subject to translation:
  endogenous_nuclear_RNA_Pol_II_transcript
Remarks:
Fig. 1.
Citations:
Van Eden M. E., Byrd M. P., Sherrill K. W., Lloyd R. E. (2004) Demonstrating internal ribosome entry sites in eukaryotic mRNAs using stringent RNA test procedures. RNA. 10(4):720-730
Last change to the database: 2015-04-16 16:45:23 GMT+1