The nucleic acid data:
IRESite Id: 184 Version: 11
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2009-09-04 14:58:55
IRESite record type:
  negative_control_plasmid_with_promoter_and_without_putative_IRES
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  3UTR_incomplete
The mRNA/+RNA description: 
Putative in vivo transcript from an empty vector pRF/pGL3R used as a negative control in many experiments.
Although the plasmid sequence is known the exact location of the transcribed region is unknown. Our guess is
based on the pDsRed2-C1 vector description from Clontech (Catalog #6974-1) and we conclude the major
transcription start points could be at positions: 146, 184, 190, 195. The mRNA sequence used here starts from
the most downstream putative transcription start site (5'-TATTCCAGAAGTAGTGA...) and continues to the end of
the late SV40 poly(A) signal sequence (...AGTAAAACCTCTACAAATGTGGTA-3'). The chimeric intron in the transcribed
region 276-408 is omitted from this mRNA sequence (information derived from GI:56089682).
The mRNA/+RNA sequence represented in the +DNA notation:


Warning: mRNA sequence when devoid of trailing 'A's is still not a substring of the plasmid sequence. Is it because an intron is spliced out? Stay calm then. :-)
Credibility of mRNA sequence:
  guessed_as_the_sequence_was_never_published_by_authors_nor_described_in_sufficient_detail
The name of the plasmid:
pRF
The name of the promoter used to express this mRNA:
  SV40
Aliases of the plasmid name:
Alias: pGL3R
Description of the plasmid (facultative for promoter-less plasmid records):
Additional transcripts were detected by Coldwell et al. (2000) Fig. 5, Wang et al. (2005) Fig. 6, Han and Zhang (2002) Fig. 9, Han et al. (2003) Fig. 7. It is supposed that the transcript is a result of alternative splicing and that it is present with the unspliced, full transcript in ratio 0.8:1.0 (Coldwell et al. (2000), pp. 902).
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  yes
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  yes
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
heterogeneous_population_of_molecules_found
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
not_tested
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
no_promoter_confirmed
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Cercopithecus aethiops COS-7 (ATCC CRL-1651)
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pRF.jpg
A promoter reported in cDNA corresponding to IRES sequence:
  no (not convincing)
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 2 Last change: 2008-05-22 16:31:28
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
RLuc
The description of the protein encoded in this ORF:
Renilla luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  192-1127
ORF
ORF position:   2
Version: 2 Last change: 2008-05-22 16:31:28
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
FLuc
The description of the protein encoded in this ORF:
Firefly luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1195-2847
Remarks:
The plasmid possibly results in multiple mRNA types generated by alternative splicing whenever a splice
acceptor site occurs in the putative IRES region tested within this plasmid. Refer to Coldwell et al. (2000)
and Figure 5 and text on page 902.



When IRESite curator tried to re-create the sequence in silico following up the procedure described in the
original article we ended up with a sequence lacking the SV40 enhancer. This was kindly brought up by K.
Spriggs and therefore we have inserted in 264bp long region into the resulting sequence:

TGAACGATGGAGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTT
TGAACGATGGAGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTC
TGAACGATGGAGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCT
GCCTGCTGGGGAGCCTGGGGACTTTCCACACCTGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCCTAACTGACA
CACATTCCACAGCGGATC
Citations:
Stoneley M., Paulin F. E., Le Quesne J. P., Chappell S. A., Willis A. E. (1998) C-Myc 5' untranslated region contains an internal ribosome entry segment. Oncogene. 16(3):423-428
Wang Z., Weaver M., Magnuson N. S. (2005) Cryptic promoter activity in the DNA sequence corresponding to the pim-1 5'-UTR. Nucleic Acids Res. 33(7):2248-2258
Coldwell M. J., Mitchell S. A., Stoneley M., MacFarlane M., Willis A. E. (2000) Initiation of Apaf-1 translation by internal ribosome entry. Oncogene. 19(7):899-905
Han B., Zhang J. T. (2002) Regulation of gene expression by internal ribosome entry sites or cryptic promoters: the eIF4G story. Mol. Cell. Biol. 22(21):7372-7384
Han B., Dong Z., Liu Y., Chen Q., Hashimoto K., Zhang J. T. (2003) Regulation of constitutive expression of mouse PTEN by the 5'-untranslated region. Oncogene. 22(34):5325-5337
Last change to the database: 2015-04-16 16:45:23 GMT+1