The nucleic acid data:
IRESite Id: 210 Version: 8
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2007-01-23 00:00:00
IRESite record type:
  plasmid_with_promoter_and_putative_IRES_without_translational_characterization
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  hopefully_full-length_mRNA
The mRNA/+RNA description: 
In vitro T7 transcript containing renilla_luciferase - hairpin_from_multiple_cloning_site -
CVB3_nt1-750 - 45_nt_of_FMDV_2A_protease - firefly_luciferase and terminated at XbaI site immediately after
the STOP codon. A fusion protein CVB3+FMDV+Fluc should be translated from the second cistron (N-terminal 31
additional aminoacids fused to FLuc).
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_reverse_engineered_and_should_match_experiment
The name of the plasmid:
pRSTF-CVB3
The name of the promoter used to express this mRNA:
  T7
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
CVB3
The origin of IRES in the plasmid:
  viral
The donor organism of the IRES segment:
Human coxsackievirus B3
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pRSTF-CVB3.jpg
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
RLuc
The description of the protein encoded in this ORF:
Renilla luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  12-956
ORF
ORF position:   2
Version: 1 Last change: 2006-07-22 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
FLuc-fusion
The description of the protein encoded in this ORF:
Firefly luciferase to which is fused coding part of CVB3 IRES (atgggaGCGGCCGC) which is followed by FMDV 2A protease fragment aattttgaccttctcaagttggcgggagacgtcgagtccaaccct and additional 34 bases of unknown origin and then finally comes the FLuc ORF.
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1774-3519
Remarks:
The plasmid with one mismatch encodes complete protease except the very last aminoacid residue fused to the
firefly-luciferase reporter protein. The cleavage protein causes release of the N-terminal
part of the protein while some ribosomes can resume protein synthesis with prolyl-tRNA.

>gi|4007043|emb|AJ007572.1|FMV7572  Foot-and-mouth disease virus, derived from C3Arg85, clone 15
Length=8161

 Score = 81.8 bits (41),  Expect = 1e-13
 Identities = 44/45 (97%), Gaps = 0/45 (0%)
 Strand=Plus/Plus

Query  1     AATTTTGACCTTCTCAAGTTGGCGGGAGACGTCGAGTCCAACCCT  45
             |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct  3881  AATTTTGACCTTCTTAAGTTGGCGGGAGACGTCGAGTCCAACCCT  3925


LOCUS       FMV7572                 8161 bp    RNA     linear   VRL 15-APR-2005
DEFINITION  Foot-and-mouth disease virus, derived from C3Arg85, clone 15.
ACCESSION   AJ007572
VERSION     AJ007572.1  GI:4007043
[...]
FEATURES             Location/Qualifiers
     source          1..8161
                     /organism="Foot-and-mouth disease virus"
                     /virion
                     /mol_type="genomic RNA"
                     /strain="C3Arg85"
                     /isolate="clone 15"
                     /db_xref="taxon:12110"
     source          1..8161
                     /organism="Foot-and-mouth disease virus"
                     /virion
                     /mol_type="genomic RNA"
                     /strain="C3Arg85"
                     /isolate="clone 15"
                     /db_xref="taxon:12110"
     CDS             1082..8068
                     /codon_start=1
                     /product="polyprotein"
                     /protein_id="CAA07561.1"
                     /db_xref="GI:4007044"
[...]
     mat_peptide     3881..3928
                     /product="2A protein"
Citations:
Jang G. M., Leong L. E., Hoang L. T., Wang P. H., Gutman G. A., Semler B. L. (2004) Structurally distinct elements mediate internal ribosome entry within the 5'-noncoding region of a voltage-gated potassium channel mRNA. J. Biol. Chem. 279(46):47419-47430
IRESs:
IRES:
Version: 4 Last change: 2007-01-23 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  CVB3
The functional status of IRES:
  functional
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1032-1781
How IRES boundaries were determined:
experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  76
3'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  825
5'-end of IRES relative to first base of the START codon of the downstream ORF:
  -742
3'-end of IRES relative to first base of the START codon of the downstream ORF:
  7
The sequence of IRES region aligned to its secondary structure (if available):


Citations:
Jang G. M., Leong L. E., Hoang L. T., Wang P. H., Gutman G. A., Semler B. L. (2004) Structurally distinct elements mediate internal ribosome entry within the 5'-noncoding region of a voltage-gated potassium channel mRNA. J. Biol. Chem. 279(46):47419-47430
Last change to the database: 2015-04-16 16:45:23 GMT+1