The nucleic acid data:
IRESite Id: 211 Version: 8
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2008-02-01 00:00:00
IRESite record type:
  plasmid_with_promoter_and_putative_IRES_without_translational_characterization
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  hopefully_full-length_mRNA
The mRNA/+RNA description: 
Putative in vivo transcript from SV40 promoter with the chimeric intron spliced out and containing
renilla_luciferase - hairpin_from_multiple_cloning_site - CVB3_nt1-750 - 45_nt_of_FMDV_2A_protease -
firefly_luciferase - late_SV40_polyA_signal. A fusion protein CVB3+FMDV+Fluc should be translated from the
second cistron (N-terminal 31 additional aminoacids fused to FLuc).
The mRNA/+RNA sequence represented in the +DNA notation:


Warning: mRNA sequence when devoid of trailing 'A's is still not a substring of the plasmid sequence. Is it because an intron is spliced out? Stay calm then. :-)
Credibility of mRNA sequence:
  reverse_engineered_sequence_and_should_match_experiment_maybe_except_both_UTRs
The name of the plasmid:
pRSTF-CVB3
The name of the promoter used to express this mRNA:
  SV40
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  yes
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  yes
A promoter reported in cDNA corresponding to IRES sequence:
  no (not convincing)
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
unclear_result
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
not_tested
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
no_promoter_confirmed
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Homo sapiens HeLa (ATCC CCL-2)
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
unclear_result
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
not_tested
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
no_promoter_confirmed
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Cercopithecus aethiops COS-1 (ATCC CRL-1650)
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
CVB3
The origin of IRES in the plasmid:
  viral
The donor organism of the IRES segment:
Human coxsackievirus B3
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pRSTF-CVB3.jpg
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
RLuc
The description of the protein encoded in this ORF:
Renilla luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  191-1135
ORF
ORF position:   2
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
FLuc-fusion
The description of the protein encoded in this ORF:
Firefly luciferase to which is fused coding part of CVB3 IRES (atgggaGCGGCCGC) which is followed by FMDV 2A protease fragment aattttgaccttctcaagttggcgggagacgtcgagtccaaccct and additional 34 bases of unknown origin and then finally comes the FLuc ORF.
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1953-3698
Remarks:
The putative transcription start site is based on annotation of other SV40promoter containing plasmids and the
one picked up is the most downstream site. Alternative splice products were observed and shown in Jang et al.
(2004) in Fig. 1D and 2A. Presence of a promoter was ruled out using promoter-less plasmid but for an unknown
reason the promoter-less plasmid (deltaSV40)pRstCVB3F lacks not only SV40 promoter/enhancer region as well as
the chimeric intron and T7 promoter region (the NheI site is just downstream after T7 promoter) but also
authors have intentionally omitted also 45bp long fragment between PacI and NheI sites containing bases 2-46
of CVB3 5'-UTR studied in pRstCVB3F plasmid: taaaacagcctgtgggttgatcccacccacagggcccattgggcg and performed
3-fragment ligation instead of 2-fragment ligation.


Jimenez et al. (2005) in Fig. 2C have confirmed the aberrant splicing issue and in Fig. 3C have shown at least
no strong promoter exists in CVB3 IRES.






The plasmid with one mismatch encodes complete protease except the very last aminoacid residue fused to the
firefly-luciferase reporter protein. The cleavage protein causes release of the N-terminal part of the protein
while some ribosomes can resume protein synthesis with prolyl-tRNA.


>gi|4007043|emb|AJ007572.1|FMV7572  Foot-and-mouth disease virus, derived from C3Arg85, clone 15
Length=8161

 Score = 81.8 bits (41),  Expect = 1e-13
 Identities = 44/45 (97%), Gaps = 0/45 (0%)
 Strand=Plus/Plus

Query  1     AATTTTGACCTTCTCAAGTTGGCGGGAGACGTCGAGTCCAACCCT  45
             |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct  3881  AATTTTGACCTTCTTAAGTTGGCGGGAGACGTCGAGTCCAACCCT  3925


LOCUS       FMV7572                 8161 bp    RNA     linear   VRL 15-APR-2005
DEFINITION  Foot-and-mouth disease virus, derived from C3Arg85, clone 15.
ACCESSION   AJ007572
VERSION     AJ007572.1  GI:4007043
[...]
FEATURES             Location/Qualifiers
     source          1..8161
                     /organism="Foot-and-mouth disease virus"
                     /virion
                     /mol_type="genomic RNA"
                     /strain="C3Arg85"
                     /isolate="clone 15"
                     /db_xref="taxon:12110"
     source          1..8161
                     /organism="Foot-and-mouth disease virus"
                     /virion
                     /mol_type="genomic RNA"
                     /strain="C3Arg85"
                     /isolate="clone 15"
                     /db_xref="taxon:12110"
     CDS             1082..8068
                     /codon_start=1
                     /product="polyprotein"
                     /protein_id="CAA07561.1"
                     /db_xref="GI:4007044"
[...]
     mat_peptide     3881..3928
                     /product="2A protein"
Citations:
Jang G. M., Leong L. E., Hoang L. T., Wang P. H., Gutman G. A., Semler B. L. (2004) Structurally distinct elements mediate internal ribosome entry within the 5'-noncoding region of a voltage-gated potassium channel mRNA. J. Biol. Chem. 279(46):47419-47430
Jimenez J., Jang G. M., Semler B. L., Waterman M. L. (2005) An internal ribosome entry site mediates translation of lymphoid enhancer factor-1. RNA. 11(9):1385-1399
IRESs:
IRES:
Version: 2 Last change: 2007-01-23 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  CVB3
The functional status of IRES:
  functional
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1211-1960
How IRES boundaries were determined:
experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  76
3'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  825
5'-end of IRES relative to first base of the START codon of the downstream ORF:
  -742
3'-end of IRES relative to first base of the START codon of the downstream ORF:
  7
The sequence of IRES region aligned to its secondary structure (if available):


Citations:
Jang G. M., Leong L. E., Hoang L. T., Wang P. H., Gutman G. A., Semler B. L. (2004) Structurally distinct elements mediate internal ribosome entry within the 5'-noncoding region of a voltage-gated potassium channel mRNA. J. Biol. Chem. 279(46):47419-47430
Last change to the database: 2015-04-16 16:45:23 GMT+1