The nucleic acid data:
IRESite Id: 220 Version: 5
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2009-09-01 20:51:39
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  hopefully_full-length_mRNA
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  LEF1
The genetic origin of this natural mRNA/+RNA:
  nuclear
The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one.
19923451 
Synonyms of the gene name:
Synonym: TCF1ALPHA
The mRNA/+RNA description: 
Homo sapiens lymphoid enhancer-binding factor 1 (LEF1) putative 3.0kb mRNA derived from newly characterized
P3 promoter. Poly(A)-tail was dropped.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  reverse_engineered_fragment_and_the_rest_is_a_guess
The organism containing this mRNA with IRES segment in its genome:
Homo sapiens
A promoter reported in cDNA corresponding to IRES sequence:
  yes
The total number of notable open-reading frames (ORFs):
  1
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
unclear_result
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
not_tested
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
weak_promoter_confirmed
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Cercopithecus aethiops COS-1 (ATCC CRL-1650)
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
LEF1
The description of the protein encoded in this ORF:
lymphoid enhancer binding factor-1
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1168-2382
Remarks:
Authentic RNA pol II promoter was confirmed between bases +280 and +640 relative to the main start site of
transcription. Comment from J. Jimenez: Our original studies of the LEF1 5'UTR were based on characterizing
a third promoter in the 5'UTR that is responsible for generating a 3.0 kb transcript. Because we had evidence
of an authentic promoter, we performed N. blot analysis. We did also attempt RT-PCR, but had technical
problems due to the high GC content of the 5'UTR.

Possibility of aberrant splicing of the plasmids with LEF-1 was ruled out only by the Northern-blot technique
(Fig. 2C and 3B).


See also DNA record GI:22858703 covering the promoter region, 5'-UTR and short part of CDS:

     misc_feature    1371..1374
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="transcription initiation site 1"
     misc_feature    1506..1507
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="transcription initiation site 2"
     misc_feature    1821..1931
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Wnt response element (WRE)"
     misc_feature    2201..2202
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="transcription initiation site 3"
     misc_feature    2325..2326
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="transcription initiation site 4"
     mRNA            <2701..>2760
                     /product="LEF1"




One mRNA record and 3 EST records confirm that transcription initiation start site is within the first 99bp of
the 5'-UTR we present here:


>dbj|AK225772.1| UniGene infoGene info Homo sapiens mRNA for lymphoid enhancer binding factor-1 variant,
clone: FCC133A10
Length=2300

 Score = 3042 bits (1647),  Expect = 0.0
 Identities = 1707/1731 (98%), Gaps = 23/1731 (1%)
 Strand=Plus/Plus

Query  99    GGACGCGCCCGGAGCCTCGCACGCGGCCAAGCTC-GGGCGTCCCCTCCCCTCGGCCGGGC  157
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct  1     GGACGCGCCCGGAGCCTCGCACGCGGCCAAGCTCGGGGCGTCCCCTCCCCTCGGCCGGGC  60

[cut]


>gb|BM919836.1| UniGene info AGENCOURT_6708394 NIH_MGC_120 Homo sapiens cDNA clone IMAGE:5749600
5', mRNA sequence.
Length=1005

 Score = 1568 bits (849),  Expect = 0.0
 Identities = 934/970 (96%), Gaps = 29/970 (2%)
 Strand=Plus/Plus

Query  26   GAGGCGCAGCCGCTCACCTGCGGGGCAGGGCGCGGAGGAGGGACCC-GG-TGCGCGCTCT  83
            |||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||
Sbjct  1    GAGGCGCAGCCGCTCACCTGCGGGGCAGGGCGCGGAGGAGGGACCCGGGCTGCGCGCTCT  60

[cut]



>gb|BQ215285.1| UniGene infoGeo AGENCOURT_7553707 NIH_MGC_92 Homo sapiens cDNA clone IMAGE:6045994
5', mRNA sequence.
Length=874

 Score = 1474 bits (798),  Expect = 0.0
 Identities = 851/873 (97%), Gaps = 17/873 (1%)
 Strand=Plus/Plus

Query  33   AGCCGCTCACCTGCGGGGCAGGGCGCGGAGGAGGGACCC-GG-TGCGCGCTCTCGGGCCG  90
            ||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||
Sbjct  1    AGCCGCTCACCTGCGGGGCAGGGCGCGGAGGAGGGACCCGGGCTGCGCGCTCTCGGGCCG  60

[cut]


>emb|CR981946.1| UniGene info CR981946 RZPD no.9016 Homo sapiens cDNA clone RZPDp9016C0812
5', mRNA sequence.
Length=678

 Score = 1149 bits (622),  Expect = 0.0
 Identities = 660/678 (97%), Gaps = 10/678 (1%)
 Strand=Plus/Plus

Query  28   GGCGCAGCCGCTCACCTGCGGGGCAGGGCGCGGAGGAGGGACCC-GG-TGCGCGCTCTCG  85
            |||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct  1    GGCGCAGCCGCTCACCTGCGGGGCAGGGCGCGGAGGAGGGACCCGGGCTGCGCGCTCTCG  60

[cut]
Citations:
Jimenez J., Jang G. M., Semler B. L., Waterman M. L. (2005) An internal ribosome entry site mediates translation of lymphoid enhancer factor-1. RNA. 11(9):1385-1399
IRESs:
IRES:
Version: 2 Last change: 2007-01-24 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  LEF1
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1-1167
Conclusion:
  weakly_supported_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
The IRES activity observed after direct RNA transfection was very low when compared to CVB3 IRES and did not
increase when PV 2A protease mRNA was cotransfected.
Citations:
Jimenez J., Jang G. M., Semler B. L., Waterman M. L. (2005) An internal ribosome entry site mediates translation of lymphoid enhancer factor-1. RNA. 11(9):1385-1399
Last change to the database: 2015-04-16 16:45:23 GMT+1