The nucleic acid data:
IRESite Id: 222 Version: 6
Originaly submitted by: Martin Mokrejš
Reviewed by: Václav Vopálenský Last change: 2009-08-30 02:23:00
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  end-to-end_full-length_mRNA
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  HCV_type_1a
The genetic origin of this natural mRNA/+RNA:
  viral
The GenBankId GI:# number of exactly this mRNA/+RNA sequence:
329737
The mRNA/+RNA description: 
Hepatitis C virus subtype 1a, strain H, complete genome.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_completely_same_as_in_the_experiment
The organism containing this mRNA with IRES segment in its genome:
Hepatitis C virus
A promoter reported in cDNA corresponding to IRES sequence:
  yes
The total number of notable open-reading frames (ORFs):
  1
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
heterogeneous_population_of_molecules_found
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
heterogeneous_population_of_molecules_found
Integrity (uniformity) of mRNA tested using primer extension :
not_tested
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
promoter_confirmed
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Homo sapiens HuH7
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Václav Vopálenský
The abbreviated name of this ORF/gene:
Polyprotein
The description of the protein encoded in this ORF:
HCV polyprotein
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  342-9377
Remarks:
There is another open-reading frame coding for the F protein. The F protein synthesis is initiated in the +1
reading frame at a non-AUG codon (GUG or GCG) overlapping codon 26 of the polyprotein (Baril et al., 2005).

A cryptic promoter activity of the HCV IRES was recently described (Masek et al., 2007) unlike by others using
insufficient combination of PCR primers (MacCallum et al, 2006).
Citations:
Inchauspe G., Zebedee S., Lee D. H., Sugitani M., Nasoff M., Prince A. M. (1991) Genomic structure of the human prototype strain H of hepatitis C virus: comparison with American and Japanese isolates. Proc. Natl. Acad. Sci. U. S. A. 88(22):10292-10296
Dumas E., Staedel C., Colombat M., Reigadas S., Chabas S., Astier-Gin T., Cahour A., Litvak S., Ventura M. (2003) A promoter activity is present in the DNA sequence corresponding to the hepatitis C virus 5' UTR. Nucleic. Acids. Res. 31(4):1275-1281
Baril M., Brakier-Gingras L. (2005) Translation of the F protein of hepatitis C virus is initiated at a non-AUG codon in a +1 reading frame relative to the polyprotein. Nucleic Acids Res. 33(5):1474-1486
Masek T, Vopalensky V, Horvath O, Vortelova L, Feketova Z, Pospisek M (2007) Hepatitis C virus internal ribosome entry site initiates protein synthesis at the authentic initiation codon in yeast. J. Gen. Virol. 7(88):1992-2002
MacCallum PR, Jack SC, Egan PA, McDermott BT, Elliott RM, Chan SW (2006) Cap-dependent and hepatitis C virus internal ribosome entry site-mediated translation are modulated by phosphorylation of eIF2alpha under oxidative stress. J. Gen. Virol. 87(Pt 11):3251-3262
IRESs:
IRES:
Version: 9 Last change: 2009-08-30 02:54:25
Originaly submitted by: Martin Mokrejš Reviewed by: Václav Vopálenský
The IRES name:
  HCV_type_1a
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1-383
Conclusion:
  strongly_supported_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):



Remarks:
For functionality of IRES is necessary that no strong secondary structures are present immediately downstream
the IRES segment in a synthetic plasmid construct. Same IRES segment is functional in some constructs whereas
it is not in others.

Secondary structure domains II-IV span the IRES. The domain III and IV are the key parts of the IRES and
include a pseudoknot structure. The structural features of many IRESs were summarized in Martinez-Salas et al.
(2001).

A recent survey of several mutations on IRES activity was published by Barrez et al. (2009), Masante et al.
(2008) and Jubin et al. (2000). Analysis of various HCV subtypes was also published (Collier et al., 1998)

Please refer also to sequence 1 from Patent WO0233376.
Citations:
Rijnbrand R., Abell G., Lemon S. M. (2000) Mutational analysis of the GB virus B internal ribosome entry site. J. Virol. 74(2):773-783
Rijnbrand R., Bredenbeek P. J., Haasnoot P. C., Kieft J. S., Spaan W. J., Lemon S. M. (2001) The influence of downstream protein-coding sequence on internal ribosome entry on hepatitis C virus and other flavivirus RNAs. RNA. 7(4):585-597
Martínez-Salas E, Ramos R, Lafuente E, López de Quinto S (2001) Functional interactions in internal translation initiation directed by viral and cellular IRES elements. J. Gen. Virol. 5(82):973-984
Barría MI, González A, Vera-Otarola J, León U, Vollrath V, Marsac D, Monasterio O, Pérez-Acle T, Soza A, López-Lastra M (2009) Analysis of natural variants of the hepatitis C virus internal ribosome entry site reveals that primary sequence plays a key role in cap-independent translation. Nucleic Acids Res. 37(3):957-971
Masante C, Mahias K, Lourenço S, Dumas E, Cahour A, Trimoulet P, Fleury H, Astier-Gin T, Ventura M (2008) Seven nucleotide changes characteristic of the hepatitis C virus genotype 3 5' untranslated region: correlation with reduced in vitro replication. J. Gen. Virol. 89(Pt 1):212-221
Collier AJ, Tang S, Elliott RM (1998) Translation efficiencies of the 5' untranslated region from representatives of the six major genotypes of hepatitis C virus using a novel bicistronic reporter assay system. J. Gen. Virol. 79(10):2359-2366
Jubin R, Vantuno NE, Kieft JS, Murray MG, Doudna JA, Lau JY, Baroudy BM (2000) Hepatitis C virus internal ribosome entry site (IRES) stem loop IIId contains a phylogenetically conserved GGG triplet essential for translation and IRES folding. J. Virol. 74(22):10430-10437
IRES trans-acting factor (ITAFS):
IRES trans-acting factor (ITAF):
Version: 3 Last change: 2009-08-30 03:21:01
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
Type of the interaction between ITAF and the RNA subject to translation:
direct_interaction_with_rna
ITAF protein characteristics:
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Václav Vopálenský
ITAF abbreviated name:
PTB-1
ITAF fullname:
polypyrimidine tract-binding protein isoform 1
ITAF description (long):
polypyrimidine tract-binding protein isoform 1 binds dsRNA with (CCU)n motif where n is at least 3. By SELEX approach it was found it binds to 5'-CAGCCUGGUGCCUCUCUUUCGG-3' (Singh et al. (1995) Science 268:1173-1176) but also UCUU or UCUUC within pyrimidine-rich sequence (Perez et al. (1997) RNA3:1334-1347).
3.1.2. Organisms or in vitro systems where this ITAF was functionally studied:
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system:
no_effect_on_translation
Method used to demonstrate ITAF effect:
in_vivo
The organism where action of this ITAF was studied:
Homo sapiens HeLa (ATCC CCL-2)
Remarks:
Depletion of mRNA for PTB-1 and decrease of protein level to about 10% did not affect activity of HCV IRES.
Data from Figure 3E,F (in vivo). These results contradict those in vitro results from Anwar et al. (2000)
J. Biol. Chem. 275:34231-34235 and from Ali and Siddiqui (1995) J. Virol. 69:6367-6375.

BS-C-1 cells and Huh-7 cells expressing PTB protein from a plasmid displayed increase in HCV IRES activity 5
times (Gosert et al., 2000).
Citations:
Mitchell S. A., Spriggs K. A., Bushell M., Evans J. R., Stoneley M., Le Quesne J. P., Spriggs R. V., Willis A. E. (2005) Identification of a motif that mediates polypyrimidine tract-binding protein-dependent internal ribosome entry. Genes Dev. 19(13):1556-1571
Gosert R, Chang KH, Rijnbrand R, Yi M, Sangar DV, Lemon SM (2000) Transient expression of cellular polypyrimidine-tract binding protein stimulates cap-independent translation directed by both picornaviral and flaviviral internal ribosome entry sites In vivo. Mol. Cell. Biol. 20(5):1583-1595
IRES trans-acting factor (ITAF):
Version: 2 Last change: 2009-08-29 13:12:35
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
Type of the interaction between ITAF and the RNA subject to translation:
direct_interaction_with_rna
ITAF protein characteristics:
Version: 2 Last change: 2009-08-29 12:19:15
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
ITAF abbreviated name:
La
ITAF fullname:
La autoantigen
ITAF description (long):
La autoantigen (p52), 52 kDa RNA binding protein, predominantly localized to nucleus, unwinds the dsRNA in ATP-dependent manner, forms a dimer
3.2.2. Organisms or in vitro systems where this ITAF was functionally studied:
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system:
required_but_available_internally
Method used to demonstrate ITAF effect:
in_vitro
In vitro system used to demonstrate ITAF effect:
HeLa cell lysate
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system:
required_but_available_internally_although_in_limiting_concentration
Method used to demonstrate ITAF effect:
in_vitro
In vitro system used to demonstrate ITAF effect:
rabbit reticulocytes lysate
Remarks:
Sequestration of the La autoantigen blocked HCV IRES-mediated translation. It binds to the region close to
initiator AUG codon of HCV core protein encompassed in the HCV IRES, it contains 3 RNA-recognition motifs
(RRM) and the one formed by aminoacid residues 112–184 was shown to have the binding capability (Mondal et
al., 2008).
Citations:
Ali N, Pruijn GJ, Kenan DJ, Keene JD, Siddiqui A (2000) Human La antigen is required for the hepatitis C virus internal ribosome entry site-mediated translation. J. Biol. Chem. 36(275):27531-27540
Mondal T, Ray U, Manna AK, Gupta R, Roy S, Das S (2008) Structural determinant of human La protein critical for internal initiation of translation of hepatitis C virus RNA. J. Virol. 23(82):11927-11938
IRES trans-acting factor (ITAF):
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
Type of the interaction between ITAF and the RNA subject to translation:
direct_interaction_with_rna
OPTIONAL: The interacting RNA base range (if any):
18-129
ITAF protein characteristics:
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
ITAF abbreviated name:
hnRNP_D
ITAF fullname:
heterogeneous ribonucleoprotein D
ITAF description (long):
heterogeneous ribonucleoprotein D (AUF1) AU-rich region binding protein
3.3.2. Organisms or in vitro systems where this ITAF was functionally studied:
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system:
stimulatory
Method used to demonstrate ITAF effect:
in_vivo
The organism where action of this ITAF was studied:
Homo sapiens
Remarks:
Distribution of HCV IRES-containing mRNAs in polysomes isolated from Huh5-15 cells transfected with siRNA
against the hnRNP D changed (Paek et al., 2008). 293T, Huh7


hnRNP D is cofractionated and coimmunoprecipitated with NSAP1, another protein known to modulate HCV IRES
activity.
Citations:
Paek KY, Kim CS, Park SM, Kim JH, Jang SK (2008) RNA-binding protein hnRNP D modulates internal ribosome entry site-dependent translation of hepatitis C virus RNA. J. Virol. 82(24):12082-12093
IRES trans-acting factor (ITAF):
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
Type of the interaction between ITAF and the RNA subject to translation:
direct_interaction_with_rna
ITAF protein characteristics:
Version: 1 Last change: 2009-08-30 01:32:33
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
ITAF abbreviated name:
NSAP1
ITAF fullname:
NS1-associated protein 1
ITAF description (long):
NS1-associated protein 1 (65 and 74 kDa) binding adenosine-rich regions, stimulates HCV IRES activity but not of EMCV, PV, c-myc
3.4.2. Organisms or in vitro systems where this ITAF was functionally studied:
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system:
stimulatory
Method used to demonstrate ITAF effect:
in_vivo
The organism where action of this ITAF was studied:
Homo sapiens
Remarks:
It would be interesting to evaluate whether NSAP1 increased activity of the internal HCV IRES promoter (Figure
3) although it is probably already ruled out by results shown in Figure 5 (Kim et al., 2004).
Citations:
Kim JH, Paek KY, Ha SH, Cho S, Choi K, Kim CS, Ryu SH, Jang SK (2004) A cellular RNA-binding protein enhances internal ribosomal entry site-dependent translation through an interaction downstream of the hepatitis C virus polyprotein initiation codon. Mol. Cell. Biol. 24(18):7878-7890
IRES trans-acting factor (ITAF):
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
Type of the interaction between ITAF and the RNA subject to translation:
direct_interaction_with_rna
ITAF protein characteristics:
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
ITAF abbreviated name:
hnRNP_R
ITAF fullname:
heterogeneous ribonucleoprotein R
ITAF description (long):
heterogeneous ribonucleoprotein R (82 and 90 kDa) homologous to NSAP1
3.5.2. Organisms or in vitro systems where this ITAF was functionally studied:
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system:
stimulatory
Method used to demonstrate ITAF effect:
in_vivo
The organism where action of this ITAF was studied:
Homo sapiens
Citations:
Kim JH, Paek KY, Ha SH, Cho S, Choi K, Kim CS, Ryu SH, Jang SK (2004) A cellular RNA-binding protein enhances internal ribosomal entry site-dependent translation through an interaction downstream of the hepatitis C virus polyprotein initiation codon. Mol. Cell. Biol. 24(18):7878-7890
IRES trans-acting factor (ITAF):
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
Type of the interaction between ITAF and the RNA subject to translation:
direct_interaction_with_rna
ITAF protein characteristics:
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
ITAF abbreviated name:
hnRNP_L
ITAF fullname:
heterogeneous ribonucleoprotein L
ITAF description (long):
heterogeneous ribonucleoprotein L (68 kDa)
3.6.2. Organisms or in vitro systems where this ITAF was functionally studied:
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system:
stimulatory
Method used to demonstrate ITAF effect:
in_vitro
In vitro system used to demonstrate ITAF effect:
HeLa cell lysate
Citations:
Hahm B, Kim YK, Kim JH, Kim TY, Jang SK (1998) Heterogeneous nuclear ribonucleoprotein L interacts with the 3' border of the internal ribosomal entry site of hepatitis C virus. J. Virol. 72(11):8782-8788
RNA:protein interactions:
The RNA:protein interaction:
Version: 6 Last change: 2009-08-30 04:04:24
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
Abbreviated name of the protein interacting with the RNA:
eIF3b
Full name of the protein interacting with the RNA:
eukaryotic translation factor eIF3; subunit b
The description of the protein interacting with the RNA:
a subunit of translation factor 3 (110/116/120 kDa)
The function of the protein interaction:
Direct interaction between eIF3b and HCV IRES might bypass the function of eIF3j which is involved in a
 cap-dependent translation initiation.
The organism where this RNA:protein interaction occurs:
Homo sapiens
Remarks:
Interaction demonstrated by filter-binding-assay and NMR titration of purified protein and radio-labeled
RNA synthesized in vitro.

Regions of interactions reported: 200-206 or 193-200 (Buratti et al., 1998); 120-332 (Perard et al., 2009)
Citations:
Perard J., Rasia R., Medenbach J., Ayala I., Boisbouvier J., Drouet E., Baudin F. (2009) Human initiation factor eIF3 subunit b interacts with HCV IRES RNA through its N-terminal RNA recognition motif. FEBS. Lett. 583(1):70-74
Buratti E, Tisminetzky S, Zotti M, Baralle FE (1998) Functional analysis of the interaction between HCV 5'UTR and putative subunits of eukaryotic translation initiation factor eIF3. Nucleic Acids Res. 26(13):3179-3187
Sizova DV, Kolupaeva VG, Pestova TV, Shatsky IN, Hellen CU (1998) Specific interaction of eukaryotic translation initiation factor 3 with the 5' nontranslated regions of hepatitis C virus and classical swine fever virus RNAs. J. Virol. 72(6):4775-4782
The RNA:protein interaction:
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
Abbreviated name of the protein interacting with the RNA:
RPS5
Full name of the protein interacting with the RNA:
ribosomal protein S5
The description of the protein interacting with the RNA:
ribosomal protein S5, p25
The organism where this RNA:protein interaction occurs:
Homo sapiens HeLa (ATCC CCL-2)
Remarks:
It was postulated that not the mis-reported RPS9 but RPS5 interacts with HCV IRES (Fukushi et al., 2001).
Citations:
Fukushi S, Okada M, Stahl J, Kageyama T, Hoshino FB, Katayama K (2001) Ribosomal protein S5 interacts with the internal ribosomal entry site of hepatitis C virus. J. Biol. Chem. 24(276):20824-20826
The RNA:protein interaction:
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
Abbreviated name of the protein interacting with the RNA:
IGF2BP1
Full name of the protein interacting with the RNA:
IGF2 mRNA binding protein 1
The description of the protein interacting with the RNA:
insulin-like growth factor mRNA binding protein
The organism where this RNA:protein interaction occurs:
Homo sapiens HuH7
Citations:
Weinlich S, Hüttelmaier S, Schierhorn A, Behrens SE, Ostareck-Lederer A, Ostareck DH (2009) IGF2BP1 enhances HCV IRES-mediated translation initiation via the 3'UTR. RNA. 8(15):1528-1542
The RNA:protein interaction:
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
Abbreviated name of the protein interacting with the RNA:
eIF3_p170
Full name of the protein interacting with the RNA:
eIF3_p170
The description of the protein interacting with the RNA:
eIF3 subunit p170
The interacting RNA base range: 195
The organism where this RNA:protein interaction occurs:
Cercopithecus aethiops COS-1 (ATCC CRL-1650)
Remarks:
Similar results were also obtained with HeLa cells.
Citations:
Buratti E, Tisminetzky S, Zotti M, Baralle FE (1998) Functional analysis of the interaction between HCV 5'UTR and putative subunits of eukaryotic translation initiation factor eIF3. Nucleic Acids Res. 26(13):3179-3187
Sizova DV, Kolupaeva VG, Pestova TV, Shatsky IN, Hellen CU (1998) Specific interaction of eukaryotic translation initiation factor 3 with the 5' nontranslated regions of hepatitis C virus and classical swine fever virus RNAs. J. Virol. 72(6):4775-4782
Regions with experimentally determined secondary structures:
A region with the experimentally determined secondary structure:
IRESite 2D Struct Id: 33
Version: 1 Last change: 2009-08-28 19:19:35
Originaly submitted by: Tomáš Mašek Reviewed by: Martin Mokrejš
The function of the 2D structure:
IRES
The 2D structure causes frameshift:
no
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents):
1-383
The underlying nucleic acid sequence and structure of the mapped region:



Remarks:
Preliminary structure was determined by alignment of N2 and Hutchinson HCV strains coupled to GBV-B
primary sequence. In vitro transcripts of HCV region 1-399 were mapped by several ribonucleases. The structure
shown here is from Figure 1 in the article.
5.1.1. Enzymes used to characterize at least partially the 2D structure.
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 62
The temperature (in degrees of Celsia):
20
The enzymatic method used to determine the 2D structure:
ribonuclease T1
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH
7.50
Li+ [mM]
0
Na+ [mM]
0
K+ [mM]
50.00
Mg2+ [mM]
10.00
Ca2+ [mM]
0
Cl- [mM]
70.00
Tris [mM]
10.00
BSA [mM]
0
HEPES [mM]
0
EGTA [mM]
0
EDTA [mM]
0
cacodylate [mM]
0
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 63
The temperature (in degrees of Celsia):
20
The enzymatic method used to determine the 2D structure:
ribonuclease T2
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH
7.50
Li+ [mM]
0
Na+ [mM]
0
K+ [mM]
50.00
Mg2+ [mM]
10.00
Ca2+ [mM]
0
Cl- [mM]
70.00
Tris [mM]
10.00
BSA [mM]
0
HEPES [mM]
0
EGTA [mM]
0
EDTA [mM]
0
cacodylate [mM]
0
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 64
The temperature (in degrees of Celsia):
20
The enzymatic method used to determine the 2D structure:
ribonuclease V1
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH
7.50
Li+ [mM]
0
Na+ [mM]
0
K+ [mM]
50.00
Mg2+ [mM]
10.00
Ca2+ [mM]
0
Cl- [mM]
70.00
Tris [mM]
10.00
BSA [mM]
0
HEPES [mM]
0
EGTA [mM]
0
EDTA [mM]
0
cacodylate [mM]
0
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 65
The temperature (in degrees of Celsia):
20
The enzymatic method used to determine the 2D structure:
S1 nuclease
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH
7.50
Li+ [mM]
0
Na+ [mM]
0
K+ [mM]
50.00
Mg2+ [mM]
10.00
Ca2+ [mM]
0
Cl- [mM]
70.00
Tris [mM]
10.00
BSA [mM]
0
HEPES [mM]
0
EGTA [mM]
0
EDTA [mM]
0
cacodylate [mM]
0
Other buffer components and their relative concentrations:
1 mM ZnSO4
Citations:
Honda M., Brown E. A., Lemon S. M. (1996) Stability of a stem-loop involving the initiator AUG controls the efficiency of internal initiation of translation on hepatitis C virus RNA. RNA. 2(10):955-968
A region with the experimentally determined secondary structure:
IRESite 2D Struct Id: 47
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The function of the 2D structure:
IRES
The 2D structure causes frameshift:
no
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents):
36-126
The underlying nucleic acid sequence and structure of the mapped region:



5.2.1. Enzymes used to characterize at least partially the 2D structure.
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 79
The temperature (in degrees of Celsia):
20
The enzymatic method used to determine the 2D structure:
ribonuclease V1
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH
7.60
Li+ [mM]
0
Na+ [mM]
0
K+ [mM]
0
Mg2+ [mM]
10.00
Ca2+ [mM]
0
Cl- [mM]
20.00
Tris [mM]
10.00
BSA [mM]
0
HEPES [mM]
0
EGTA [mM]
0
EDTA [mM]
0
cacodylate [mM]
0
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 80
The temperature (in degrees of Celsia):
20
The enzymatic method used to determine the 2D structure:
S1 nuclease
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH
7.60
Li+ [mM]
0
Na+ [mM]
0
K+ [mM]
0
Mg2+ [mM]
10.00
Ca2+ [mM]
0
Cl- [mM]
20.00
Tris [mM]
10.00
BSA [mM]
0
HEPES [mM]
0
EGTA [mM]
0
EDTA [mM]
0
cacodylate [mM]
0
Other buffer components and their relative concentrations:
1 mM ZnSO4
Citations:
Honda M, Beard MR, Ping LH, Lemon SM (1999) A phylogenetically conserved stem-loop structure at the 5' border of the internal ribosome entry site of hepatitis C virus is required for cap-independent viral translation. J. Virol. 2(73):1165-1174
A region with the experimentally determined secondary structure:
IRESite 2D Struct Id: 48
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The function of the 2D structure:
IRES
The 2D structure causes frameshift:
no
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents):
1-344
The underlying nucleic acid sequence and structure of the mapped region:



Remarks:
Data from Figure 3. To align the structure of the AG94 strain over the underlying sequence of this IRESite
record we had to drop an unpaired base corresponding to one of the C bases. Below is an alignment of the AG94
sequence to this IRESite sequence.

>IRESite_Id:222 HCV_type_1a virus
          Length = 9416

 Score =  591 bits (338), Expect = e-169
 Identities = 343/345 (99%), Gaps = 1/345 (0%)
 Strand = Plus / Plus


Query: 1   gccagccccctgatgggggcgacactccaccatgaatcactcccctgtgaggaactactg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gccagccccctgatgggggcgacactccaccatgaatcactcccctgtgaggaactactg 60


Query: 61  tcttcacgcagaaagcgtctagccatggcgttagtatgagtgtcgtgcagcctccaggac 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  tcttcacgcagaaagcgtctagccatggcgttagtatgagtgtcgtgcagcctccaggac 120


Query: 121 ccccccctcccgggagagccatagtggtctgcggaaccggtgagtacaccggaattgcca 180
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 ccc-ccctcccgggagagccatagtggtctgcggaaccggtgagtacaccggaattgcca 179


Query: 181 ggacgaccgggtcctttcttggataaacccgctcaatgcctggagatttgggcgtgcccc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 180 ggacgaccgggtcctttcttggataaacccgctcaatgcctggagatttgggcgtgcccc 239


Query: 241 cgcaagactgctagccgagtagtgttgggtcgcgaaaggccttgtggtactgcctgatag 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 240 cgcaagactgctagccgagtagtgttgggtcgcgaaaggccttgtggtactgcctgatag 299


Query: 301 ggtgcttgcgagtgccccgggaggtctcgtagaccgtgcatcatg 345
           |||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 300 ggtgcttgcgagtgccccgggaggtctcgtagaccgtgcaccatg 344
5.3.1. Enzymes used to characterize at least partially the 2D structure.
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 81
The temperature (in degrees of Celsia):
20
The enzymatic method used to determine the 2D structure:
ribonuclease T1/T2 mix
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH
7.50
Li+ [mM]
0
Na+ [mM]
0
K+ [mM]
50.00
Mg2+ [mM]
10.00
Ca2+ [mM]
0
Cl- [mM]
70.00
Tris [mM]
10.00
BSA [mM]
0
HEPES [mM]
0
EGTA [mM]
0
EDTA [mM]
0
cacodylate [mM]
0
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 82
The temperature (in degrees of Celsia):
20
The enzymatic method used to determine the 2D structure:
S1 nuclease
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH
7.50
Li+ [mM]
0
Na+ [mM]
0
K+ [mM]
50.00
Mg2+ [mM]
10.00
Ca2+ [mM]
0
Cl- [mM]
70.00
Tris [mM]
10.00
BSA [mM]
0
HEPES [mM]
0
EGTA [mM]
0
EDTA [mM]
0
cacodylate [mM]
0
Other buffer components and their relative concentrations:
1 mM ZnSO4
Citations:
Brown EA, Zhang H, Ping LH, Lemon SM (1992) Secondary structure of the 5' nontranslated regions of hepatitis C virus and pestivirus genomic RNAs. Nucleic Acids Res. 19(20):5041-5045
A region with the experimentally determined secondary structure:
IRESite 2D Struct Id: 49
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The function of the 2D structure:
IRES
The 2D structure causes frameshift:
no
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents):
40-362
The underlying nucleic acid sequence and structure of the mapped region:



Remarks:
Data from Figure 1.
5.4.1. Enzymes used to characterize at least partially the 2D structure.
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 83
The temperature (in degrees of Celsia):
37
The enzymatic method used to determine the 2D structure:
ribonuclease T1/V1 mix
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH
7.50
Li+ [mM]
0
Na+ [mM]
0
K+ [mM]
100.00
Mg2+ [mM]
2.50
Ca2+ [mM]
0
Cl- [mM]
100.00
Tris [mM]
20.00
BSA [mM]
0
HEPES [mM]
0
EGTA [mM]
0
EDTA [mM]
0
cacodylate [mM]
0
Other buffer components and their relative concentrations:
2.5 mM acetate
2 mM dithiothreitol
Citations:
Kolupaeva VG, Pestova TV, Hellen CU (2000) An enzymatic footprinting analysis of the interaction of 40S ribosomal subunits with the internal ribosomal entry site of hepatitis C virus. J. Virol. 14(74):6242-6250
A region with the experimentally determined secondary structure:
IRESite 2D Struct Id: 50
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The function of the 2D structure:
IRES
The 2D structure causes frameshift:
no
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents):
44-118
The underlying nucleic acid sequence and structure of the mapped region:



Remarks:
Data from Figure 7.
Citations:
Odreman-Macchioli F, Baralle FE, Buratti E (2001) Mutational analysis of the different bulge regions of hepatitis C virus domain II and their influence on internal ribosome entry site translational ability. J. Biol. Chem. 276(45):41648-41655
Last change to the database: 2015-04-16 16:45:23 GMT+1