The nucleic acid data:
IRESite Id: 225 Version: 5
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2008-02-01 00:00:00
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  hopefully_full-length_mRNA
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  CVB3
The genetic origin of this natural mRNA/+RNA:
  viral
The GenBankId GI:# number of exactly this mRNA/+RNA sequence:
54399972
The mRNA/+RNA description: 
Human coxsackievirus B3 strain 20, complete genome.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  only_fragment_published_or_from_author_and_the_rest_is_a_guess
The organism containing this mRNA with IRES segment in its genome:
Human coxsackievirus B3 20
A promoter reported in cDNA corresponding to IRES sequence:
  no (not convincing)
The total number of notable open-reading frames (ORFs):
  1
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
heterogeneous_population_of_molecules_found
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
not_tested
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
no_promoter_confirmed
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Homo sapiens HeLa (ATCC CCL-2)
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
polyprotein
The description of the protein encoded in this ORF:
viral polyprotein
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  743-7300
Remarks:
Jang et al. (2004) have shown that in Fig. 1D and 2A that probably aberrant splicing of pRstCVB3F occurs in
HeLa cell and that the presence of shorter transcripts is not due to a cryptic promoter in CVB3 IRES region.

Jimenez et al. (2005) have shown that in Fig. 2C that aberrant splicing is an issue with pRstCVB3F. Presence
of a promoter was ruled out using promoter-less plasmid (Jang et al., 2004) but for an unknown reason the
promoter-less plasmid (deltaSV40)pRstCVB3F lacks not only SV40 promoter/enhancer region as well as the
chimeric intron and T7 promoter region (the NheI site is just downstream after T7 promoter) but also authors
have intentionally omitted also 45bp long fragment between PacI and NheI sites containing bases 2-46 of CVB3
5'-UTR studied in pRstCVB3F plasmid: taaaacagcctgtgggttgatcccacccacagggcccattgggcg and performed 3-fragment
ligation instead of 2-fragment ligation.
Citations:
Jang G. M., Leong L. E., Hoang L. T., Wang P. H., Gutman G. A., Semler B. L. (2004) Structurally distinct elements mediate internal ribosome entry within the 5'-noncoding region of a voltage-gated potassium channel mRNA. J. Biol. Chem. 279(46):47419-47430
Jimenez J., Jang G. M., Semler B. L., Waterman M. L. (2005) An internal ribosome entry site mediates translation of lymphoid enhancer factor-1. RNA. 11(9):1385-1399
IRESs:
IRES:
Version: 5 Last change: 2009-08-18 16:24:54
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  CVB3
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1-750
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
The results could be biased by inclusion of FMDV 2A protease in the plasmid vector (IRESite_Id:211). IRESite
annotators  believe the observed reporter protein yields were decreased by the "protease" sequence so the IRES
appears weaker than it actually is. The observed aberrant splicing makes the in vivo of Jang et al. and
Jimenez et al. results hard to interpret.

However, in vitro toe-print assays were done by Bailey and Tapprich (2007).
Citations:
Jang G. M., Leong L. E., Hoang L. T., Wang P. H., Gutman G. A., Semler B. L. (2004) Structurally distinct elements mediate internal ribosome entry within the 5'-noncoding region of a voltage-gated potassium channel mRNA. J. Biol. Chem. 279(46):47419-47430
Jimenez J., Jang G. M., Semler B. L., Waterman M. L. (2005) An internal ribosome entry site mediates translation of lymphoid enhancer factor-1. RNA. 11(9):1385-1399
Bailey J. M., Tapprich W. E. (2007) Structure of the 5' nontranslated region of the coxsackievirus b3 genome: Chemical modification and comparative sequence analysis. J. Virol. 81(2):650-668
IRES trans-acting factor (ITAFS):
IRES trans-acting factor (ITAF):
Version: 2 Last change: 2009-08-30 13:01:19
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
Type of the interaction between ITAF and the RNA subject to translation:
direct_interaction_with_rna
OPTIONAL: The interacting RNA base range (if any):
603-606
ITAF protein characteristics:
Version: 2 Last change: 2009-08-29 12:19:15
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
ITAF abbreviated name:
La
ITAF fullname:
La autoantigen
ITAF description (long):
La autoantigen (p52), 52 kDa RNA binding protein, predominantly localized to nucleus, unwinds the dsRNA in ATP-dependent manner, forms a dimer
3.1.2. Organisms or in vitro systems where this ITAF was functionally studied:
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system:
required_but_available_internally
Method used to demonstrate ITAF effect:
in_vitro
In vitro system used to demonstrate ITAF effect:
HeLa cell lysate
Remarks:
The region 603-606 is a 'GAGA' containing loop, complying the general GNRA motif.
Citations:
Ray PS, Das S (2002) La autoantigen is required for the internal ribosome entry site-mediated translation of Coxsackievirus B3 RNA. Nucleic Acids Res. 20(30):4500-4508
Bhattacharyya S, Das S (2005) Mapping of secondary structure of the spacer region within the 5'-untranslated region of the coxsackievirus B3 RNA: possible role of an apical GAGA loop in binding La protein and influencing internal initiation of translation. Virus Res. 108(1-2):89-100
Regions with experimentally determined secondary structures:
A region with the experimentally determined secondary structure:
IRESite 2D Struct Id: 46
Version: 3 Last change: 2009-08-30 13:01:19
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The function of the 2D structure:
IRES
The 2D structure causes frameshift:
no
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents):
1-647
The underlying nucleic acid sequence and structure of the mapped region:



Remarks:
Authors state that they observed no influence on the mapped structure when they used transcripts longer at the
3'-end.
Citations:
Bailey J. M., Tapprich W. E. (2007) Structure of the 5' nontranslated region of the coxsackievirus b3 genome: Chemical modification and comparative sequence analysis. J. Virol. 81(2):650-668
Last change to the database: 2010-03-03 23:22:41 GMT+1