The nucleic acid data:
IRESite Id: 231 Version: 3
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2009-09-04 15:01:31
IRESite record type:
  negative_control_plasmid_with_promoter_and_without_putative_IRES
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  our_best_guess
The mRNA/+RNA description: 
Putative in vitro derived T7 run-off transcript from BamHI linearized pRF plasmid.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_reverse_engineered_and_should_match_experiment
The name of the plasmid:
pRF
The name of the promoter used to express this mRNA:
  T7
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pRF.jpg
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 1 Last change: 2008-05-22 16:37:01
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
RLuc
The description of the protein encoded in this ORF:
Renilla luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  50-985
ORF
ORF position:   2
Version: 1 Last change: 2008-05-22 16:37:01
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
FLuc
The description of the protein encoded in this ORF:
Firefly luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1053-2705
Remarks:
It seems the pRF (Stoneley et al., 1998) plasmid has mostly been used for in vivo (please refer to
IRESiteID:184) assays. The first case we know of when a linearized pRF plasmid has been used for in
vitro studies is the work of Wang et al. (2005).


When IRESite curator tried to re-create the sequence in silico following up the procedure described in the
original article we ended up with a sequence lacking the SV40 enhancer. This was kindly brought up by K.
Spriggs and therefore we have inserted in 264bp long region into the resulting sequence:

TGAACGATGGAGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTT
TGAACGATGGAGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTC
TGAACGATGGAGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCT
GCCTGCTGGGGAGCCTGGGGACTTTCCACACCTGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCCTAACTGACA
CACATTCCACAGCGGATC
Citations:
Wang Z., Weaver M., Magnuson N. S. (2005) Cryptic promoter activity in the DNA sequence corresponding to the pim-1 5'-UTR. Nucleic Acids Res. 33(7):2248-2258
Stoneley M., Paulin F. E., Le Quesne J. P., Chappell S. A., Willis A. E. (1998) C-Myc 5' untranslated region contains an internal ribosome entry segment. Oncogene. 16(3):423-428
Last change to the database: 2015-04-16 16:45:23 GMT+1