The nucleic acid data:
IRESite Id: 241 Version: 2
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2007-07-24 00:00:00
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  nonexisting_chimera_of_GenBank_record_and_tested_IRES_fragment
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  ELH
The genetic origin of this natural mRNA/+RNA:
  nuclear
The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one.
155731 
The mRNA/+RNA description: 
A. californica egg-laying hormone mRNA, complete cds. The 5'-UTR of 293nt has been replaced by IRESite
annotator with the 319nt long 5'-UTR actually studied.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  only_fragment_published_or_from_author_and_the_rest_is_a_guess
The organism containing this mRNA with IRES segment in its genome:
Aplysia californica
A promoter reported in cDNA corresponding to IRES sequence:
  no
The total number of notable open-reading frames (ORFs):
  1
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
not_tested
Integrity (uniformity) of mRNA tested using RNase protection:
homogeneous_population_of_molecules_confirmed
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
not_tested
Integrity (uniformity) of mRNA tested using RT-PCR:
homogeneous_population_of_molecules_confirmed
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
no_promoter_confirmed
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Aplysia californica
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
ELH
The description of the protein encoded in this ORF:
egg-laying hormone
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  294-926
Remarks:
There is no complete mRNA sequence in GenBank which would match reasonably the IRES sequence tested. Probably
the best overall match is to 155731. The sequence of GI:155731 has been edited for IRESite aims - so the
5'-UTR is replaced completely by the tested sequence with extra sequences 1-13nt and 196-208nt and few
mismatches. The edited record has 5'-UTR with 319nt instead of 293 as originally. Below is the original
pairwise alignment as reported by BLAST:


>gi|155731|gb|M29347.1|APLELHABJ
 A.californica egg-laying hormone mRNA, complete cds Length=1003

 Score =  297 bits (150),  Expect = 1e-77
 Identities = 174/182 (95%), Gaps = 0/182 (0%)
 Strand=Plus/Plus

Query  14   CTTTACCGACAACGTCCAGCGTCCCAGTCGAGAAGTAAGTAGTCCGAGCTGTGAGCATAA  73
Sbjct  1    .....................GT.......................C....C........  60

Query  74   CTCTACCAGAGAAACGCGCGCTTTATTGGTCAAGATAGACGGAAGCCGGCGGTTGAAGGC  133
Sbjct  61   ...................A...............C...................G.C..  120

Query  134  AAAGGTTGACTCGGAAGCTGAGAGATTGTTGAGTAACACGCAGAAGTCTTGAAAGTATCA  193
Sbjct  121  ............................................................  180

Query  194  AG  195
Sbjct  181  ..  182


 Score =  210 bits (106),  Expect = 2e-51
 Identities = 109/110 (99%), Gaps = 0/110 (0%)
 Strand=Plus/Plus

Query  209  ATTGAACATATTTCAAGGAACTTGGTTTCGGTGAAGTCGTCAATTCCTTTTATCGTCAAC  268
Sbjct  184  ..................G.........................................  243

Query  269  GTTTCCACAGCCCTCAGAATAGAAATTTCCAACAAGCCAAAGCCTACGTA  318
Sbjct  244  ..................................................  293



Presence of a cryptic promoter and possibility of aberrant splicing were ruled out using RNase protection
and RT-PCR.
Citations:
Dyer J. R., Michel S., Lee W., Castellucci V. F., Wayne N. L., Sossin W. S. (2003) An activity-dependent switch to cap-independent translation triggered by eIF4E dephosphorylation. Nat. Neurosci. 6(3):219-220
IRESs:
IRES:
Version: 2 Last change: 2007-07-24 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  ELH
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1-319
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
It is not clear what is the ELH IRES activity in scale to other IRESs, especially to some known positive
controls.
Citations:
Dyer J. R., Michel S., Lee W., Castellucci V. F., Wayne N. L., Sossin W. S. (2003) An activity-dependent switch to cap-independent translation triggered by eIF4E dephosphorylation. Nat. Neurosci. 6(3):219-220
Last change to the database: 2015-04-16 16:45:23 GMT+1