The shape of the nucleic acid molecule translated: linear
The quality of the mRNA/+RNA sequence: nonexisting_chimera_of_GenBank_record_and_tested_IRES_fragment
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule: ELH
The genetic origin of this natural mRNA/+RNA: nuclear
The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one. 155731
The mRNA/+RNA description:
A. californica egg-laying hormone mRNA, complete cds. The 5'-UTR of 293nt has been replaced by IRESite
annotator with the 319nt long 5'-UTR actually studied.
The mRNA/+RNA sequence represented in the +DNA notation:
Credibility of mRNA sequence: only_fragment_published_or_from_author_and_the_rest_is_a_guess
The organism containing this mRNA with IRES segment in its genome:
A promoter reported in cDNA corresponding to IRES sequence: no
The total number of notable open-reading frames (ORFs): 1
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot: not_tested
Integrity (uniformity) of mRNA tested using RNase protection: homogeneous_population_of_molecules_confirmed
Integrity (uniformity) of mRNA tested using 5'-RACE: not_tested
Integrity (uniformity) of mRNA tested using primer extension : not_tested
Integrity (uniformity) of mRNA tested using RT-PCR: homogeneous_population_of_molecules_confirmed
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR): not_tested
Integrity (uniformity) of mRNA tested using RNAi: not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping: not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid: no_promoter_confirmed
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter: not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks: not_tested
The description of the protein encoded in this ORF: egg-laying hormone
The translational frameshift (ribosome slippage) involved: 0
The ribosome read-through involved: no
The alternative forms of this protein occur by the alternative initiation of translation: not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents): 294-926
Remarks:
There is no complete mRNA sequence in GenBank which would match reasonably the IRES sequence tested. Probably
the best overall match is to 155731. The sequence of GI:155731 has been edited for IRESite aims - so the
5'-UTR is replaced completely by the tested sequence with extra sequences 1-13nt and 196-208nt and few
mismatches. The edited record has 5'-UTR with 319nt instead of 293 as originally. Below is the original
pairwise alignment as reported by BLAST:
>gi|155731|gb|M29347.1|APLELHABJ
A.californica egg-laying hormone mRNA, complete cds Length=1003
Score = 297 bits (150), Expect = 1e-77
Identities = 174/182 (95%), Gaps = 0/182 (0%)
Strand=Plus/Plus
Query 14 CTTTACCGACAACGTCCAGCGTCCCAGTCGAGAAGTAAGTAGTCCGAGCTGTGAGCATAA 73
Sbjct 1 .....................GT.......................C....C........ 60
Query 74 CTCTACCAGAGAAACGCGCGCTTTATTGGTCAAGATAGACGGAAGCCGGCGGTTGAAGGC 133
Sbjct 61 ...................A...............C...................G.C.. 120
Query 134 AAAGGTTGACTCGGAAGCTGAGAGATTGTTGAGTAACACGCAGAAGTCTTGAAAGTATCA 193
Sbjct 121 ............................................................ 180
Query 194 AG 195
Sbjct 181 .. 182
Score = 210 bits (106), Expect = 2e-51
Identities = 109/110 (99%), Gaps = 0/110 (0%)
Strand=Plus/Plus
Query 209 ATTGAACATATTTCAAGGAACTTGGTTTCGGTGAAGTCGTCAATTCCTTTTATCGTCAAC 268
Sbjct 184 ..................G......................................... 243
Query 269 GTTTCCACAGCCCTCAGAATAGAAATTTCCAACAAGCCAAAGCCTACGTA 318
Sbjct 244 .................................................. 293
Presence of a cryptic promoter and possibility of aberrant splicing were ruled out using RNase protection
and RT-PCR.