The nucleic acid data:
IRESite Id: 243 Version: 9
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2009-09-01 21:15:02
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  our_best_guess
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  NRF
The genetic origin of this natural mRNA/+RNA:
  nuclear
The GenBankId GI:# number of exactly this mRNA/+RNA sequence:
7406601
Synonyms of the gene name:
Synonym: NF-kappaB-repressing factor
The mRNA/+RNA description: 
Homo sapiens mRNA for transcription factor NRF (NF-kappaB-repressing factor), a nuclear inhibitor of
NF-kappaB. Poly(A)-tail was dropped from the sequence.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_completely_same_as_in_the_experiment
The organism containing this mRNA with IRES segment in its genome:
Homo sapiens
A promoter reported in cDNA corresponding to IRES sequence:
  no (not convincing)
The total number of notable open-reading frames (ORFs):
  1
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
homogeneous_population_of_molecules_confirmed
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
not_tested
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
not_tested
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Mus musculus C243
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
NRF
The description of the protein encoded in this ORF:
transcription factor NRF
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  654-1820
Remarks:
Please refer also to GI:119960145 (EF158333.1) submitted by Oumard et al. (2000).

The 5'-most sequence of this mRNA (AJ011812.2, GI:7406601, 3736 bp) is confirmed by the following EST
since position 144 and downstream:


>gb|DR002872.1| UniGene info TC114069 Human fetal brain, large insert, pCMV expression library
Homo sapiens cDNA clone TC114069 5' similar to Homo sapiens NF-kappaB repressing factor (NKRF), mRNA sequence.
Length=756

 Score = 1369 bits (741),  Expect = 0.0
 Identities = 746/748 (99%), Gaps = 1/748 (0%)
 Strand=Plus/Plus

Query  144  CACTTTGCCAGTAAGAGTCTATTCAAATTGGCTTCTGAGTCCATTTGACACAACACCTTT  203
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  9    CACTTTGCCAGTAAGAGTCTATTCAAATTGGCTTCTGAGTCCATTTGACACAACACCTTT  68

[cut]

However, several additional mRNA records confirm this exon (all three from the same lab):
EF216688.1  GI:124431166, Nourbakhsh,M., 2809bp
EF216689.1  GI:124431168, Nourbakhsh,M., 3764bp
EF158333.1  GI:119960145, Nourbakhsh,M., 988bp (missing part of CDS and whole 3'-UTR)

There is one clone with genomic DNA insert:
AC004913.2  GI:5523836, Waterston,R.H. (genomic DNA)




There is one more entry confiming existence of the  5'-end sequence:

>gb|ES316131.1| UniGene info Met-p03-C12 Metastatic Melanoma SSH Library (Met Library) Homo  sapiens cDNA
Length=473

 Score =  601 bits (325),  Expect = 1e-168
 Identities = 364/383 (95%), Gaps = 1/383 (0%)
 Strand=Plus/Plus

Query  1    CAGAGTAATGACATGGTTCCTTCCATCCTCCAAAGGTGACCAATAATAGTTTGTAAGTAT  60
            |||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct  91   CAGAATAATGACATGGTTCCTTCCATCCTCCAAAGGTGACCAATAATAGTTGGTAAGTAT  150

Query  61   CATTATGAACTAATGAATTTTCAACATATTTGATATATTTCAATCCATTGCCATCATTGT  120
            ||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||
Sbjct  151  CATTATGAACTAATGAATTGTCAACATATTTGATATATTTCAATCCATGGCCATCATTGT  210

Query  121  TCTTATCGATATTTGAGTTGGCTCACTTTGCCAGTAAGAGTCTATTCAAATTGGCTTCTG  180
            ||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||||||
Sbjct  211  TCTTATCGATATTGGAGTGGGCTCACTTTGCCAGTAAGAGTCTATTCAAATGGGCTTCTG  270

Query  181  AGTCCATTTGACACAACACCTTTGATCTTTGACAGTTTCCTTGGTTTTAGGTGCTAGATG  240
            |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct  271  AGTCCATTTGACACAACACCTTTGATCTTTGAGAGTTTCCTTGGTTTGAGGTGCTAGATG  330

Query  241  ATTTCTCAGGCTCACCTTAGACATTTCC-TGCCACAGACTTAGAATCAGCCATTTCTCTA  299
            |||||||||||||||||||||||||| | ||||| ||| |||||||||| ||||||||||
Sbjct  331  ATTTCTCAGGCTCACCTTAGACATTTGCGTGCCATAGATTTAGAATCAGGCATTTCTCTA  390

Query  300  AGGACCCTGATTCCATTTCATGAGAAATGATAGAGACCACAATCAAAACAAGTCATGAAT  359
            ||||||||||||||||| |||||||||||||||||| || |||||||||||||||||| |
Sbjct  391  AGGACCCTGATTCCATTGCATGAGAAATGATAGAGAGCAAAATCAAAACAAGTCATGAGT  450

Query  360  TTATACTGATATTTTCAATTCAA  382
             ||||||||||||||||||||||
Sbjct  451  GTATACTGATATTTTCAATTCAA  473


There is yet one more match to DR002872 (not shown).

All other ESTs confirm only the sequence downstream since the position 636:

>gb|BI544578.1| UniGene info 603242218F1 NIH_MGC_95 Homo sapiens cDNA clone IMAGE:5284565
5', mRNA sequence.
Length=740

 Score = 1022 bits (553),  Expect = 0.0
 Identities = 580/591 (98%), Gaps = 10/591 (1%)
 Strand=Plus/Plus

Query  636   AGGTACAGCCCACGCTTGATGGAAAAAATTCTCCAAATGGCTGAAGGTATTGATATTGGG  695
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  155   AGGTACAGCCCACGCTTGATGGAAAAAATTCTCCAAATGGCTGAAGGTATTGATATTGGG  214

[cut]

>emb|AL539002.3| UniGene info AL539002 Homo sapiens FETAL BRAIN Homo sapiens cDNA clone CS0DF030YI23
5-PRIME, mRNA sequence.
Length=1101

 Score = 1498 bits (811),  Expect = 0.0
 Identities = 825/833 (99%), Gaps = 3/833 (0%)
 Strand=Plus/Plus

Query  636   AGGTACAGCCCACGCTTGATGGAAAAAATTCTCCAAATGGCTGAAGGTATTGATATTGGG  695
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  179   AGGTACAGCCCACGCTTGATGGAAAAAATTCTCCAAATGGCTGAAGGTATTGATATTGGG  238

[cut]

>gb|BI554152.1| UniGene info 603235573F1 NCI_CGAP_Brn67 Homo sapiens cDNA clone IMAGE:5309490
5', mRNA sequence.
Length=702

 Score =  835 bits (452),  Expect = 0.0
 Identities = 496/515 (96%), Gaps = 11/515 (2%)
 Strand=Plus/Plus

Query  636   AGGTACAGCCCACGCTTGATGGAAAAAATTCTCCAAATGGCTGAAGGTATTGATATTGGG  695
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  190   AGGTACAGCCCACGCTTGATGGAAAAAATTCTCCAAATGGCTGAAGGTATTGATATTGGG  249

[cut]

>gb|BG705887.1| UniGene info 602669385F1 NIH_MGC_96 Homo sapiens cDNA clone IMAGE:4792052
5', mRNA sequence.
Length=791

 Score = 1149 bits (622),  Expect = 0.0
 Identities = 648/659 (98%), Gaps = 7/659 (1%)
 Strand=Plus/Plus

Query  636   AGGTACAGCCCACGCTTGATGGAAAAAATTCTCCAAATGGCTGAAGGTATTGATATTGGG  695
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  135   AGGTACAGCCCACGCTTGATGGAAAAAATTCTCCAAATGGCTGAAGGTATTGATATTGGG  194

[cut]

>gb|BI599571.1| UniGene info 603247745F1 NIH_MGC_96 Homo sapiens cDNA clone IMAGE:5299667
5', mRNA sequence.
Length=572

 Score =  795 bits (430),  Expect = 0.0
 Identities = 436/439 (99%), Gaps = 1/439 (0%)
 Strand=Plus/Plus

Query  636   AGGTACAGCCCACGCTTGATGGAAAAAATTCTCCAAATGGCTGAAGGTATTGATATTGGG  695
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  135   AGGTACAGCCCACGCTTGATGGAAAAAATTCTCCAAATGGCTGAAGGTATTGATATTGGG  194

[cut]

>gb|BI836552.1| UniGene info 603089514F1 NIH_MGC_120 Homo sapiens cDNA clone IMAGE:5228666
5', mRNA sequence.
Length=889

 Score = 1319 bits (714),  Expect = 0.0
 Identities = 756/774 (97%), Gaps = 11/774 (1%)
 Strand=Plus/Plus

Query  636   AGGTACAGCCCACGCTTGATGGAAAAAATTCTCCAAATGGCTGAAGGTATTGATATTGGG  695
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  119   AGGTACAGCCCACGCTTGATGGAAAAAATTCTCCAAATGGCTGAAGGTATTGATATTGGG  178

[cut]

>gb|BG741433.1| UniGene info 602632215F1 NCI_CGAP_Skn3 Homo sapiens cDNA clone IMAGE:4777539
5', mRNA sequence.
Length=913

 Score = 1262 bits (683),  Expect = 0.0
 Identities = 741/766 (96%), Gaps = 15/766 (1%)
 Strand=Plus/Plus

Query  636   AGGTACAGCCCACGCTTGATGGAAAAAATTCTCCAAATGGCTGAAGGTATTGATATTGGG  695
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  134   AGGTACAGCCCACGCTTGATGGAAAAAATTCTCCAAATGGCTGAAGGTATTGATATTGGG  193

[cut]





Baranick et al. (2008) studied shorter region -163 to -1 (relative to initiator ATG) whereas Oumard et al.
(2000) studied -653 to -1. Baranick et al. (2008) in Supplementary Figure 9B showed a putative mammalian
branching site YNYTRAC (the actual sequence -47_TTTTAAC_-41).

The exon containing this putative IRES is always the first exon, probably different promoter is involved
than the one discussed further in this text. The many other ESTs in dbEST covering a different splice
variant utilizing the 3'-splice acceptor site of this putative IRES appear to be transcribed from an
upstream promoter and therefore their second exon overlaps in tiny part with the 3'-border of the "IRES"
(from -17 downstream) (Baranick et al. (2008), Supplementary Figure 13).
Citations:
Oumard A., Hennecke M., Hauser H., Nourbakhsh M. (2000) Translation of NRF mRNA is mediated by highly efficient internal ribosome entry. Mol. Cell. Biol. 20(8):2755-2759
IRESs:
IRES:
Version: 7 Last change: 2009-04-08 16:46:36
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  NRF_-653_-17
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1-637
Conclusion:
  probably_not_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
Reboll et al. (2007) studied "IRES" activity of many mutants spanning the "IRES" region and determined a
secondary structure of 77bp long region immediately preceding the initiator ATG.

Baranick et al. (2008) postulate that the "IRES" activity observed was mainly due to the splice artifacts
(Fig. 3D). The sequence originally reported as the 5'-UTR contains -18_agGT_-16 (the 3'-splice acceptor site
is in lowercase) based on several EST records lacking the region -653 to -17. Mutation affecting the 3'-splice
acceptor site decreased "IRES" activity of NRF to about 50% of EMCV, about 8-fold drop. It is unclear why
mutations to the putative branching site caused only marginal decrease whereas a mutation to the region
preceding the 3'-splice acceptor site caused in contrast much deeper drop (Fig. 4B). Similarly puzzling
results of the mutations shown in Supplementary Figure 10 (mutant4 should have been close to parental control
if one expects that the changes were not to be affecting splicing).
Citations:
Oumard A., Hennecke M., Hauser H., Nourbakhsh M. (2000) Translation of NRF mRNA is mediated by highly efficient internal ribosome entry. Mol. Cell. Biol. 20(8):2755-2759
Baranick B. T., Lemp N. A., Nagashima J., Hiraoka K., Kasahara N., Logg C. R. (2008) Splicing mediates the activity of four putative cellular internal ribosome entry sites. Proc. Natl. Acad. Sci. U. S. A. 105(12):4733-4738
IRES trans-acting factor (ITAFS):
IRES trans-acting factor (ITAF):
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
Type of the interaction between ITAF and the RNA subject to translation:
direct_interaction_with_rna
OPTIONAL: The interacting RNA base range (if any):
578-639
ITAF protein characteristics:
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
ITAF abbreviated name:
JKTBP1
ITAF fullname:
JKTBP1
ITAF description (long):
JKTBP1 binds AU-rich elements of 3'-UTRs, related to hnRNP D/AUF1
3.1.2. Organisms or in vitro systems where this ITAF was functionally studied:
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system:
required_but_available_internally
Method used to demonstrate ITAF effect:
in_vivo
The organism where action of this ITAF was studied:
Homo sapiens HeLa (ATCC CCL-2)
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system:
required_but_available_internally
Method used to demonstrate ITAF effect:
in_vitro
In vitro system used to demonstrate ITAF effect:
HeLa cell lysate
Remarks:
Authors mention the JKTBP1 protein is abundant in many cell lines. Binding was shown in Figure 5B.
Citations:
Reboll M. R., Oumard A., Gazdag A. C., Renger I., Ritter B., Schwarzer M., Hauser H., Wood M., Yamada M., Resch K., Nourbakhsh M. (2007) NRF IRES activity is mediated by RNA binding protein JKTBP1 and a 14-nt RNA element. RNA. 13(8):1328-1340
Regions with experimentally determined secondary structures:
A region with the experimentally determined secondary structure:
IRESite 2D Struct Id: 32
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The function of the 2D structure:
IRES
The 2D structure causes frameshift:
unknown
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents):
577-656
The underlying nucleic acid sequence and structure of the mapped region:



Citations:
Reboll M. R., Oumard A., Gazdag A. C., Renger I., Ritter B., Schwarzer M., Hauser H., Wood M., Yamada M., Resch K., Nourbakhsh M. (2007) NRF IRES activity is mediated by RNA binding protein JKTBP1 and a 14-nt RNA element. RNA. 13(8):1328-1340
Last change to the database: 2015-04-16 16:45:23 GMT+1