The nucleic acid data:
IRESite Id: 26 Version: 8
Originaly submitted by: Václav Vopálenský Submission date: 2005-08-17 00:00:00
Reviewed by: Václav Vopálenský Last change: 2007-05-11 00:00:00
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  3UTR_possibly_incomplete
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  ERBV
The genetic origin of this natural mRNA/+RNA:
  viral
The GenBankId GI:# number of exactly this mRNA/+RNA sequence:
1262769
The mRNA/+RNA description: 
Equine Rhinovirus type 2 genomic sequence.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  guessed_as_the_sequence_was_never_published_by_authors_nor_described_in_sufficient_detail
The organism containing this mRNA with IRES segment in its genome:
Equine rhinitis B virus 1436/71
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The total number of notable open-reading frames (ORFs):
  1
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 2 Last change: 2007-05-11 00:00:00
Originaly submitted by: Václav Vopálenský Reviewed by: Václav Vopálenský
The abbreviated name of this ORF/gene:
polyprotein
The description of the protein encoded in this ORF:
Equine Rhinovirus type 2 polyprotein
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  904-8664
Remarks:
Results indicate that translation mostly occurs at AUG2 in the wild-type ERBV IRES but may initiate at AUG3 in
the absence of AUG2 or further downstream in the absence of both AUG2 and AUG3. Bicistronic T7 transcripts
were transcribed in vivo in recombinant vaccinia virus infected cells or sythesized in vitro and translated in
rabbit reticulocyte lysates.
Citations:
Hinton T. M., Crabb B. S. (2001) The novel picornavirus Equine rhinitis B virus contains a strong type II internal ribosomal entry site which functions similarly to that of Encephalomyocarditis virus. J. Gen. Virol. 82(Pt 9):2257-2269
IRESs:
IRES:
Version: 9 Last change: 2007-05-11 00:00:00
Originaly submitted by: Václav Vopálenský Reviewed by: Václav Vopálenský
The IRES name:
  ERBV_162-920
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  162-920
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
Deletion of the 5' end to nt 189 had no apparent effect on the IRES activity. A further 5' truncation
to nt 351 caused a substantial decrease in the IRES activity. Truncation of the 3' end of the IRES to AUG1
(to nt 895) also led to a major reduction in the IRES activity; however, truncation to AUG2 (to nt 904) or
AUG3 (to nt 916) had little effect.



1436/71           TTTTGTAACTGAGGTTTTGACATCTCATTGTTTTTGAGCCCCAACGTCTTGGTGGATGCT
Hinton_1-920      TTTTGTAACTGAGGTTTTGACATCTCATTGTTTTTGAGCCCCAACGTCTTGGTGGATGCT
                  ************************************************************

1436/71           CAAAGAAGATTACTCTTGATGCTTGGCTCTCAGAAAGAATGGCACCTCAATGTTTTGAGA
Hinton_1-920      CAAAGAAGATTACTCTTGATGCTTGGCTCTCAGAAAGAATGGCACCTCAATGTTTTGAGA
                  ************************************************************

1436/71           CCCGATTCTTTTGAGTCGAGACCATTTCCCCTTCCCTGAAGATTGCTTTTCTTCCAACTA
Hinton_1-920      CCCGATTCTTTTGAGTCGAGACCATTTCCCCTTCCCTGAAGATTGCTTTTCTTCCAACTA
                  ************************************************************

1436/71           AACCCCTATTGATGTGTTGGTCGTTTGCCAATCGGAGGGCGACAGG--------------
Hinton_1-920      AACCCCTATTGATGTGTTGGTCGTTTGCCAATCGGAGGGCGACAGGTCGTTTGCCAATCG
                  **********************************************
                         ^ base 189                             ^ base 227

1436/71           ------------CACAGGTCGCTCCGAGTTCTAGTAGTGTGGGAACTTGTTACTACTGAT
Hinton_1-920      GAGGGCGACAGGCACAGGTCGCTCCGAGTTCTAGTAGTGTGGGAACTTGTTACTACTGAT
                              ************************************************
                             ^ base 252
Citations:
Hinton T. M., Crabb B. S. (2001) The novel picornavirus Equine rhinitis B virus contains a strong type II internal ribosomal entry site which functions similarly to that of Encephalomyocarditis virus. J. Gen. Virol. 82(Pt 9):2257-2269
Last change to the database: 2015-04-16 16:45:23 GMT+1