The nucleic acid data:
IRESite Id: 263 Version: 1
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2007-02-21 00:00:00
IRESite record type:
  plasmid_with_promoter_and_putative_IRES_without_translational_characterization
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  our_best_guess
The mRNA/+RNA description: 
Putative in vivo CMV transcript of pCAT-EMCV-eGFP including the SV40 early poly(A) signal.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_completely_same_as_in_the_experiment
The name of the plasmid:
pCAT-EMCV-eGFP
The name of the promoter used to express this mRNA:
  CMV
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
EMCV-R
The origin of IRES in the plasmid:
  viral
The donor organism of the IRES segment:
Encephalomyocarditis virus Ruckert
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pCAT-EMCV-eGFP.jpg
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
CAT
The description of the protein encoded in this ORF:
chloramphenicol acetyltransferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  70-729
ORF
ORF position:   2
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
eGFP
The description of the protein encoded in this ORF:
enhanced green fluorescent protein
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1443-2162
Citations:
Grobe K., Esko J. D. (2002) Regulated translation of heparan sulfate N-acetylglucosamine N-deacetylase/n-sulfotransferase isozymes by structured 5'-untranslated regions and internal ribosome entry sites. J. Biol. Chem. 277(34):30699-30706
IRESs:
IRES:
Version: 2 Last change: 2011-04-08 22:08:17
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  EMCV-R_261-845
The functional status of IRES:
  functional
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  814-1400
How IRES boundaries were determined:
experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  85
3'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  671
5'-end of IRES relative to first base of the START codon of the downstream ORF:
  -629
3'-end of IRES relative to first base of the START codon of the downstream ORF:
  -43
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
There are some differences to the reference EMCV-R strain IRES (Query is the IRES region tagged in this
IRESite entry sequence):

Query: 481 acatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggg 540
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 741 acatgctttacatgtgtttagtcgaggtt-aaaaaacgtctaggccccccgaaccacggg 799


Query: 541 gacgtggttttcctttgaaaaacacgatgataagct-t-gccacaacc 586
           |||||||||||||||||||||||||||||||||  | | |||||||||
Sbjct: 800 gacgtggttttcctttgaaaaacacgatgataa--tatggccacaacc 845
Citations:
Grobe K., Esko J. D. (2002) Regulated translation of heparan sulfate N-acetylglucosamine N-deacetylase/n-sulfotransferase isozymes by structured 5'-untranslated regions and internal ribosome entry sites. J. Biol. Chem. 277(34):30699-30706
Last change to the database: 2015-04-16 16:45:23 GMT+1