The nucleic acid data:
IRESite Id: 266 Version: 6
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2007-02-21 00:00:00
IRESite record type:
  plasmid_with_promoter_and_putative_IRES_translationally_characterized
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  hopefully_full-length_mRNA
The mRNA/+RNA description: 
Putative in vivo transcript from CMV promoter of pCAT-NDST4L-delta100-eGFP including the SV40 early poly(A)
signal. 112 bp were deleted on the 3'-end of the putative NDST4L IRES.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_reverse_engineered_and_should_match_experiment
The name of the plasmid:
pCAT-NDST4L-delta100-eGFP
The name of the promoter used to express this mRNA:
  CMV
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
NDST
The origin of IRES in the plasmid:
  nuclear
The donor organism of the IRES segment:
Mus musculus
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pCAT-NDST4L-delta100-eGFP.jpg
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
CAT
The description of the protein encoded in this ORF:
chloramphenicol acetyltransferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  70-729
ORF
ORF position:   2
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
eGFP
The description of the protein encoded in this ORF:
enahnced green fluorescent protein
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1374-2093
Remarks:
NDST4 is transcribed from two different promoters. The longer NDST4L and shorter NDST4S share only partially
the first exon (432bp vs. 140bp), and completely share the second exon. The upstream promoter is TATA-less.
The downstream promoter includes CAAT/TATA box 77/68 bases upstream the transcription start site and is
located in the first cistron. Total lengths of 5'-UTRs are 669 and 377bp. See Fig. 1 in Grobe and Esko (2002).

The splice sites in all NDST variants are A(G/G)TAAGT...intron...CA(G/N).

A region of the first exon shared by both NDST4L and NDST4S is similar to htrp3 mRNA 5'-UTR region:

>gi|2295902|gb|U47050.1|HSU47050 Homo sapiens calcium influx channel (htrp3) mRNA, complete cds
Length=3417

 Score =  119 bits (60),  Expect = 3e-24
 Identities = 109/124 (87%), Gaps = 1/124 (0%)
 Strand=Plus/Plus

Query  28   GAGTGCTCTCAGAATCCTGTTGAGGCAGATGGCACGAACTGAAAGCTCCG-CTAATTAAC  86
Sbjct  4    .........TG....AT.............T...T..............TT.........  63

Query  87   GTGGAGCCAAGTAAACCTGAATTCTGGATATCTCATTTTCTAACTTCGGATAAATTCAAG  146
Sbjct  64   C...........G.........A.............G.......ACG.............  123

Query  147  TTAG  150
Sbjct  124  ....  127
Citations:
Grobe K., Esko J. D. (2002) Regulated translation of heparan sulfate N-acetylglucosamine N-deacetylase/n-sulfotransferase isozymes by structured 5'-untranslated regions and internal ribosome entry sites. J. Biol. Chem. 277(34):30699-30706
IRESs:
IRES:
Version: 1 Last change: 2007-04-16 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  NDST4L-delta100
The functional status of IRES:
  defective
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  793-1352
How IRES boundaries were determined:
experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  64
3'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  623
5'-end of IRES relative to first base of the START codon of the downstream ORF:
  -581
3'-end of IRES relative to first base of the START codon of the downstream ORF:
  -22
The sequence of IRES region aligned to its secondary structure (if available):


Citations:
Grobe K., Esko J. D. (2002) Regulated translation of heparan sulfate N-acetylglucosamine N-deacetylase/n-sulfotransferase isozymes by structured 5'-untranslated regions and internal ribosome entry sites. J. Biol. Chem. 277(34):30699-30706
The translation experiments:
Translation results:
IRESite Translation Id: 336
Version: 1 Last change: 2007-02-20 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The translation method used to study IRES function:
in vivo
The organism used for translation:
Cricetulus griseus CHO-K1 (ATCC CCL-61)
The temperature (in degrees of Celsia):
37
The relative translation efficiency in % of this IRES:
  5.000
Name of IRES used as the positive control:
  EMCV
Name of the plasmid used as the positive control.
pCAT-EMCV-eGFP
IRESite Id of the plasmid used as positive control.
  263
The relative translation efficiency in % of the positive control:
  100.000
The size (length) of intercistronic region in the positive control:
713
The effect of 5'-cap analogs on translation:
not tested
Rapamycin affects translation:
not tested
Type of RNA subject to translation:
  endogenous_nuclear_RNA_Pol_II_transcript
Remarks:
Fig. 6
Citations:
Grobe K., Esko J. D. (2002) Regulated translation of heparan sulfate N-acetylglucosamine N-deacetylase/n-sulfotransferase isozymes by structured 5'-untranslated regions and internal ribosome entry sites. J. Biol. Chem. 277(34):30699-30706
Last change to the database: 2015-04-16 16:45:23 GMT+1