The nucleic acid data:
IRESite Id: 286 Version: 3
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2008-10-19 12:24:34
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  5UTR_incomplete
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  ERAV
The genetic origin of this natural mRNA/+RNA:
  viral
The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one.
2231133 
The mRNA/+RNA description: 
Equine rhinitis A virus, genome incomplete at the 5'-end
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  reverse_engineered_fragment_and_the_rest_is_a_guess
The organism containing this mRNA with IRES segment in its genome:
Equine rhinitis A virus 1 393/76
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The total number of notable open-reading frames (ORFs):
  5
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
Lab
The description of the protein encoded in this ORF:
Lab polyprotein
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  yes
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  850-7596
ORF
ORF position:   2
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
Lab
The description of the protein encoded in this ORF:
Lab polyprotein
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  yes
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  853-7596
ORF
ORF position:   3
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
Lb
The description of the protein encoded in this ORF:
Lb polyprotein
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  yes
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  913-7596
ORF
ORF position:   4
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
Lb
The description of the protein encoded in this ORF:
Lb polyprotein
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  yes
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  916-7596
ORF
ORF position:   5
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
polyprotein
The description of the protein encoded in this ORF:
polyprotein
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  yes
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1210-7596
Remarks:
The genomic sequence was in silico assembled by IRESite curator as a merge of sequences provided by T. Hinton
and merged with GI:2231133 from the same lab. The sequences mostly overlap, so in summary 59bp sequence
'TTAAGCTTGTACCTGTAGCGTCAGTAAAACGCAGAAACCAAACGCAATTGCCTGTAGCG' was prepended to the original GenBank record.
According to the article by Hinton et al. (2000) they studied only the 5'-UTR region downstream the poly(C)
tract and thus their base position +1 was actually the one downstream poly(C) tract. Thus, the sequence
reconstructed here is still an incomplete genome at the 5'-end at least.

There are two AUGAUG regions: 852-857 and 915-920. Results indicate that translation predominantly occurs from
the first pair of AUG codons and that the latter 855-AUG-857 appears to be the major initiator. Translation in
ERAV also appears to initiate from the second pair of AUG codons, probably 918-AUG-920, but this occurs at
only about 1/10 of the level of initiation from 850-AUG-857. Full IRES activity requires nt 245 to 961
downstream of the poly(C) tract. Bicistronic T7 transcripts were transcribed in vivo in recombinant vaccinia
virus infected human cells BHK21.
Citations:
Hinton T. M., Li F., Crabb B. S. (2000) Internal ribosomal entry site-mediated translation initiation in equine rhinitis A virus: similarities to and differences from that of foot-and-mouth disease virus. J. Virol. 74(24):11708-11716
Hinton T. M., Ross-Smith N., Warner S., Belsham G. J., Crabb B. S. (2002) Conservation of L and 3C proteinase activities across distantly related aphthoviruses. J. Gen. Virol. 83(Pt 12):3111-3121
IRESs:
IRES:
Version: 1 Last change: 2007-04-16 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  ERAV_245-961
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  245-956
Conclusion:
  strongly_supported_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
Deletion of the 5' end to nt 245 had no apparent effect on the IRES activity. A further 5' truncation to nt
338 caused a substantial decrease in the IRES activity. Truncation of the 3' end of the IRES to nt 921 also
led to reduction in IRES activity.
Citations:
Hinton T. M., Li F., Crabb B. S. (2000) Internal ribosomal entry site-mediated translation initiation in equine rhinitis A virus: similarities to and differences from that of foot-and-mouth disease virus. J. Virol. 74(24):11708-11716
Last change to the database: 2015-04-16 16:45:23 GMT+1