The nucleic acid data:
IRESite Id: 332 Version: 0
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš
IRESite record type:
  promoter-less_plasmid_with_putative_IRES
The name of the plasmid:
(deltaSV40)pRstCVB3F
Description of the plasmid (facultative for promoter-less plasmid records):
The promoter-less plasmid was created by blunt-end ligation of (deltaSV40)pRSTF plasmid backbone (NotI/NcoI) with 2 fragments (NheI-PacI and NheI-XbaI) from pRstCVB3F plasmid. The region between PacI and NheI contained bases 2-46 of CVB3 5'-UTR.
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  no
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  no
A promoter reported in cDNA corresponding to IRES sequence:
  no (not convincing)
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
not_tested
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
not_tested
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
no_promoter_confirmed
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Homo sapiens HeLa (ATCC CCL-2)
The origin of IRES in the plasmid:
  viral
The donor organism of the IRES segment:
Human coxsackievirus B3
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
CVB3
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
(deltaSV40)pRstCVB3F.jpg
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
RLuc
The description of the protein encoded in this ORF:
Renilla luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  33-977
ORF
ORF position:   2
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
FLuc
The description of the protein encoded in this ORF:
Firefly luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1843-3495
Remarks:
Jang et al. (2004) constructed this promoter-less plasmid (deltaSV40)pRstCVB3F but for an unknown reason this
plasmid lacks not only SV40 promoter/enhancer region as well as the chimeric intron and T7 promoter region
(the NheI site is just downstream after T7 promoter) but also authors have intentionally omitted also 45bp
long fragment between PacI and NheI sites containing bases 2-46 of CVB3 5'-UTR studied in pRstCVB3F plasmid:
taaaacagcctgtgggttgatcccacccacagggcccattgggcg and performed 3-fragment ligation instead of 2-fragment
ligation.

Jimenez et al. (2005) in Fig. 2C have confirmed the aberrant splicing issue and in Fig. 3C have shown at least
no strong promoter exists in CVB3 IRES using this plasmid.

In summary, it is not the very best plasmid construct to show that CVB3 IRES has no cryptic promoter activity.
Definitely, the pRstCVB3F plasmid contained the 45bp long IRES(promoter?) sequence in contrast to this
promoter-less vector.
Citations:
Jang G. M., Leong L. E., Hoang L. T., Wang P. H., Gutman G. A., Semler B. L. (2004) Structurally distinct elements mediate internal ribosome entry within the 5'-noncoding region of a voltage-gated potassium channel mRNA. J. Biol. Chem. 279(46):47419-47430
IRESs:
IRES:
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  CVB3
The functional status of IRES:
  functional
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1054-1757
How IRES boundaries were determined:
experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  77
3'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  780
5'-end of IRES relative to first base of the START codon of the downstream ORF:
  -789
3'-end of IRES relative to first base of the START codon of the downstream ORF:
  -86
The sequence of IRES region aligned to its secondary structure (if available):


Citations:
Jang G. M., Leong L. E., Hoang L. T., Wang P. H., Gutman G. A., Semler B. L. (2004) Structurally distinct elements mediate internal ribosome entry within the 5'-noncoding region of a voltage-gated potassium channel mRNA. J. Biol. Chem. 279(46):47419-47430
Last change to the database: 2015-04-16 16:45:23 GMT+1