The nucleic acid data:
IRESite Id: 337 Version: 4
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2009-09-17 00:00:41
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  both_UTRs_incomplete
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  IGF2
The genetic origin of this natural mRNA/+RNA:
  nuclear
The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one.
33051 
Synonyms of the gene name:
Synonym: IGFII
Synonym: IGF-2
Synonym: IGF-II
The mRNA/+RNA description: 
Homo sapiens insulin-like growth factor 2, leader 2 mRNA produced from P2 promoter (5.0 kb) in fetal tissues
and transformed cells (possibly incomplete UTRs).
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  only_fragment_published_or_from_author
The organism containing this mRNA with IRES segment in its genome:
Homo sapiens
A promoter reported in cDNA corresponding to IRES sequence:
  no (not convincing)
The total number of notable open-reading frames (ORFs):
  1
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
homogeneous_population_of_molecules_confirmed
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
unclear_result
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
not_tested
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Homo sapiens SK-N-MC (ATCC HTB-10)
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
homogeneous_population_of_molecules_confirmed
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
unclear_result
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
not_tested
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Homo sapiens human RD (ATTC CCL-136)
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
IGF2
The description of the protein encoded in this ORF:
insulin-like growth factor
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  574-1116
Remarks:
There are 9 exons which get combined into 4 transcripts due to 4 different promoters.
IGF2 Leader 2 mRNA produced from promoter P2 consists of 4 exons. The first exon (actually exon 4) represents
5'-UTR while exons 7, 8, 9 merge into the protein coding region and 3'-UTR (Fig. 1).
P3 transcript is annotated in GI:33003.
Regions around individual exons are:
GI:183091 exon 1
GI:183092 exon 2
GI:183093 exon 3
GI:183094 exon 4

In the article authors tried to clone IGF 2 leader 2 mRNA and place it into a plasmid vector which
was further characterized. In Fig. 6A they show alignment to other IGF 2 factors
and refer to Genbank record X53038. Alignment of the sequences shown in the pictures
reveals the region they have supposedly cloned (or at least shown in the picture because
authors did not describe primers used to amplify the cDNA nor the amplified sequence)
is longer then the annotated exon. It contains extra 25 bp on its left side with repeat
element and transcription start region.


>gi|33051|emb|X53038.1| Human insulin-like growth factor IGFII gene
           leader exon (fetal promoter)
          Length = 870

 Score =  797 bits (402), Expect = 0.0
 Identities = 402/402 (100%)
 Strand = Plus / Plus


Fig6A: 1   gttccggctcgccggccacccactgcagcttccccaaccccgcgcacagcgggcactggt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 353 gttccggctcgccggccacccactgcagcttccccaaccccgcgcacagcgggcactggt 412


Fig6A: 61  ttcgggcctctctgtctcctacgaagtccccagagcaactcggatttgggaaatttctct 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 413 ttcgggcctctctgtctcctacgaagtccccagagcaactcggatttgggaaatttctct 472


Fig6A: 121 ctagcgttgcccaaacacacttgggtcggccgcgcgccctcaggacgtggacagggaggg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 473 ctagcgttgcccaaacacacttgggtcggccgcgcgccctcaggacgtggacagggaggg 532


Fig6A: 181 cttccccgtgtccaggaaagcgaccgggcattgcccccagtctcccccaaatttgggcat 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 533 cttccccgtgtccaggaaagcgaccgggcattgcccccagtctcccccaaatttgggcat 592


Fig6A: 241 tgtccccgggtcttccaacggactgggcgttgctcccggacactgaggactggccccggg 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 593 tgtccccgggtcttccaacggactgggcgttgctcccggacactgaggactggccccggg 652


Fig6A: 301 gtctcgctcaccttcagcagcgtccaccgcctgccacagagcgttcgatcgctcgctgcc 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 653 gtctcgctcaccttcagcagcgtccaccgcctgccacagagcgttcgatcgctcgctgcc 712


Fig6A: 361 tgagctcctggtgcgcccgcggacgcagcctccagcttcgcg 402
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 713 tgagctcctggtgcgcccgcggacgcagcctccagcttcgcg 754



 Score = 34.2 bits (17), Expect = 2e-05
 Identities = 20/21 (95%)
 Strand = Plus / Plus


Fig6A: 223 tcccccaaatttgggcattgt 243
           ||||| |||||||||||||||
Sbjct: 334 tccccaaaatttgggcattgt 354






The unexpected inclusion of transcription start region could have happened because
the annotation in GenBank probably has changed during the time since 2002 (note the
"Location changed from '(350.377)..754' to '<377..754'" line:

     repeat_region   334..597
                     /rpt_type=DIRECT
                     /rpt_unit_range=334..357
                     /rpt_unit_range=575..597
     gene            <377..870
                     /gene="IGFII"
     prim_transcript <377..870
                     /gene="IGFII"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="multiple start sites
                     transcripts detected in fetal liver and leiomyosarcoma
                     tisue
                     Location changed from '(350.377)..870' to '<377..870'"
     exon            <377..754
                     /gene="IGFII"
                     /note="multiple start sites
                     Location changed from '(350.377)..754' to '<377..754'"
                     /number=4
     intron          755..870
                     /gene="IGFII"
                     /number=4



So maybe in 2002 the region 350-754 was annotated as an exon.



Interestingly, another record is annotated as exon 4 of IGF2 (GI:33052) submitted in 1991:

>emb|X56539.1|HSIGFIIG4  H.sapiens IGFII gene exon 4
Length=490

 Score =  737 bits (399),  Expect = 0.0
 Identities = 401/402 (99%), Gaps = 0/402 (0%)
 Strand=Plus/Plus

Fig6A  1    GTTCCGGCTCGCCGGCCACCCACTGCAGCTTCCCCAACCCCGCGCACAGCGGGCACTGGT  60
            ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  62   GTTCCCGCTCGCCGGCCACCCACTGCAGCTTCCCCAACCCCGCGCACAGCGGGCACTGGT  121

Fig6A  61   TTCGGGCCTCTCTGTCTCCTACGAAGTCCCCAGAGCAACTCGGATTTGGGAAATTTCTCT  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  122  TTCGGGCCTCTCTGTCTCCTACGAAGTCCCCAGAGCAACTCGGATTTGGGAAATTTCTCT  181

Fig6A  121  CTAGCGTTGCCCAAACACACTTGGGTCGGCCGCGCGCCCTCAGGACGTGGACAGGGAGGG  180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  182  CTAGCGTTGCCCAAACACACTTGGGTCGGCCGCGCGCCCTCAGGACGTGGACAGGGAGGG  241

Fig6A  181  CTTCCCCGTGTCCAGGAAAGCGACCGGGCATTGCCCCCAGTCTCCCCCAAATTTGGGCAT  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  242  CTTCCCCGTGTCCAGGAAAGCGACCGGGCATTGCCCCCAGTCTCCCCCAAATTTGGGCAT  301

Fig6A  241  TGTCCCCGGGTCTTCCAACGGACTGGGCGTTGCTCCCGGACACTGAGGACTGGCCCCGGG  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  302  TGTCCCCGGGTCTTCCAACGGACTGGGCGTTGCTCCCGGACACTGAGGACTGGCCCCGGG  361

Fig6A  301  GTCTCGCTCACCTTCAGCAGCGTCCACCGCCTGCCACAGAGCGTTCGATCGCTCGCTGCC  360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  362  GTCTCGCTCACCTTCAGCAGCGTCCACCGCCTGCCACAGAGCGTTCGATCGCTCGCTGCC  421

Fig6A  361  TGAGCTCCTGGTGCGCCCGCGGACGCAGCCTCCAGCTTCGCG  402
            ||||||||||||||||||||||||||||||||||||||||||
Sbjct  422  TGAGCTCCTGGTGCGCCCGCGGACGCAGCCTCCAGCTTCGCG  463


Hereby the exon 4 region has the following annotation (pointing to multiple transcription
start sites in the putative IRES region):

     repeat_region   43..68
                     /rpt_type=DIRECT
     gene            55..463
                     /gene="human IGFII gene"
     exon            55..463
                     /gene="human IGFII gene"
                     /number=4
     prim_transcript 55..>463
                     /gene="human IGFII gene"
                     /note="putative transcription start"
     prim_transcript 110..>463
                     /gene="human IGFII gene"
                     /note="putative transcription start"
     prim_transcript 170..>463
                     /gene="human IGFII gene"
                     /note="putative transcription start"
     prim_transcript 172..>463
                     /gene="human IGFII gene"
                     /note="putative transcription start"
     prim_transcript 219..>463
                     /gene="human IGFII gene"
                     /note="putative transcription start"
     repeat_region   284..309
                     /gene="human IGFII gene"
                     /rpt_type=DIRECT



Record GI:21397155 covers maybe leader 4 variant (produced from P4 promoter)
aligns within unannotated region at the very beginning with the sequence
shown in Figure 6A. This GenBank record could at least be used to examination
of the surrounding regions in a chromosome. Human genome databases like, like
VEGA at http://vega.sanger.ac.uk/Homo_sapiens/transview?transcript=OTTHUMT00000026060;db=core
although said to present manual annotation it does not even label transcripts
according to the published literature (leader 1, 2, 3, 4, 5 transcripts).


>GI:21397155 Gene info Homo sapiens insulin-like growth factor 2 (somatomedin A) (IGF2)
gene, complete cds
Length=9013

 GENE ID: 3481 IGF2 | insulin-like growth factor 2 (somatomedin A)
[Homo sapiens] (Over 100 PubMed links)

 Score =  737 bits (399),  Expect = 0.0
 Identities = 402/403 (99%), Gaps = 1/403 (0%)
 Strand=Plus/Plus

Fig6A  1    GTT-CCGGCTCGCCGGCCACCCACTGCAGCTTCCCCAACCCCGCGCACAGCGGGCACTGG  59
            ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  213  GTTCCCGGCTCGCCGGCCACCCACTGCAGCTTCCCCAACCCCGCGCACAGCGGGCACTGG  272

Fig6A  60   TTTCGGGCCTCTCTGTCTCCTACGAAGTCCCCAGAGCAACTCGGATTTGGGAAATTTCTC  119
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  273  TTTCGGGCCTCTCTGTCTCCTACGAAGTCCCCAGAGCAACTCGGATTTGGGAAATTTCTC  332

Fig6A  120  TCTAGCGTTGCCCAAACACACTTGGGTCGGCCGCGCGCCCTCAGGACGTGGACAGGGAGG  179
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  333  TCTAGCGTTGCCCAAACACACTTGGGTCGGCCGCGCGCCCTCAGGACGTGGACAGGGAGG  392

Fig6A  180  GCTTCCCCGTGTCCAGGAAAGCGACCGGGCATTGCCCCCAGTCTCCCCCAAATTTGGGCA  239
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  393  GCTTCCCCGTGTCCAGGAAAGCGACCGGGCATTGCCCCCAGTCTCCCCCAAATTTGGGCA  452

Fig6A  240  TTGTCCCCGGGTCTTCCAACGGACTGGGCGTTGCTCCCGGACACTGAGGACTGGCCCCGG  299
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  453  TTGTCCCCGGGTCTTCCAACGGACTGGGCGTTGCTCCCGGACACTGAGGACTGGCCCCGG  512

Fig6A  300  GGTCTCGCTCACCTTCAGCAGCGTCCACCGCCTGCCACAGAGCGTTCGATCGCTCGCTGC  359
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  513  GGTCTCGCTCACCTTCAGCAGCGTCCACCGCCTGCCACAGAGCGTTCGATCGCTCGCTGC  572

Fig6A  360  CTGAGCTCCTGGTGCGCCCGCGGACGCAGCCTCCAGCTTCGCG  402
            |||||||||||||||||||||||||||||||||||||||||||
Sbjct  573  CTGAGCTCCTGGTGCGCCCGCGGACGCAGCCTCCAGCTTCGCG  615

     gene            2699..8745
                     /gene="IGF2"
     mRNA            join(2699..3242,5941..6103,7806..7954,8248..8745)
                     /gene="IGF2"
                     /product="insulin-like growth factor 2 (somatomedin A)"






When aligning the sequence from Figure 6A against inverted sequences of EST records
(GI:9178890, 11250440, 9143792) first 20 bp conflict with the only 3 candidate ESTs
although matching fully downstream until the 3'-end of the sequence.
The sequence without a match at the very 5'-end of the studied region is
GTTCCGGCTCGCCGGCCACC.


>EST_model
          Length = 786

 Score =  757 bits (382), Expect = 0.0
 Identities = 382/382 (100%)
 Strand = Plus / Plus


Query: 21  cactgcagcttccccaaccccgcgcacagcgggcactggtttcgggcctctctgtctcct 80
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 275 cactgcagcttccccaaccccgcgcacagcgggcactggtttcgggcctctctgtctcct 334


Query: 81  acgaagtccccagagcaactcggatttgggaaatttctctctagcgttgcccaaacacac 140
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 335 acgaagtccccagagcaactcggatttgggaaatttctctctagcgttgcccaaacacac 394


Query: 141 ttgggtcggccgcgcgccctcaggacgtggacagggagggcttccccgtgtccaggaaag 200
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 ttgggtcggccgcgcgccctcaggacgtggacagggagggcttccccgtgtccaggaaag 454


Query: 201 cgaccgggcattgcccccagtctcccccaaatttgggcattgtccccgggtcttccaacg 260
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 455 cgaccgggcattgcccccagtctcccccaaatttgggcattgtccccgggtcttccaacg 514


Query: 261 gactgggcgttgctcccggacactgaggactggccccggggtctcgctcaccttcagcag 320
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 515 gactgggcgttgctcccggacactgaggactggccccggggtctcgctcaccttcagcag 574


Query: 321 cgtccaccgcctgccacagagcgttcgatcgctcgctgcctgagctcctggtgcgcccgc 380
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 575 cgtccaccgcctgccacagagcgttcgatcgctcgctgcctgagctcctggtgcgcccgc 634


Query: 381 ggacgcagcctccagcttcgcg 402
           ||||||||||||||||||||||
Sbjct: 635 ggacgcagcctccagcttcgcg 656




Further, the 402 nt long sequence (including the 121 nt long region for which secondary structure has been
mapped) does not align to any of the two splice variants insulin-like growth factor 2 (somatomedin A) (IGF2)
mRNA as annotated currently in NCBI Gene database (GI:183603939, GI:183603938).

Finally, there are 2 splice variants of INS-IGF2 mRNA, one of them (GI:145701023) is subject to
nonsense-mediated decay pathway while the second variant encode a fusion protein of INS and IGF2
(GI:109148521). However, the region studied in this work and shown in Fig. 6A does not align to any of these.

The sequence of leader 2 mRNA was assembled for the purpose of IRESite from EST records
(GI:9178890, 11250440, 9143792), incomplete sequence of leader 2 mRNA in VEGA at
http://vega.sanger.ac.uk/Homo_sapiens/transview?transcript=OTTHUMT00000026060;db=core
Citations:
Pedersen S. K., Christiansen J., Hansen T. O., Larsen M. R., Nielsen F. C. (2002) Human insulin-like growth factor II leader 2 mediates internal initiation of translation. Biochem. J. 363(Pt 1):37-44
Additional data: http://www.molbio.ku.dk/MolBioPages/abk/PersonalPages/janchr/index.htm
IRESs:
IRES:

Version: 4 Last change: 2009-09-16 23:59:29
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  IGF2_leader2
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  200-320
Conclusion:
  unproved_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):



Rendering structure of IGF2 mRNA 121 nt long with energy of -19.59 kcal/mol as calculated by RNAeval using VARNA Java applet with some IRESite improvements. Hold left mouse button to move structure parts, hold right mouse button to move whole structure, use mouse wheel to zoom. Right mouse-click opens a menu to export into JPG/SVG and many other options.

You need a Java-enabled browser to play this game.
Remarks:
Leader 2 and leader 4 monocistronic luciferase constructs and luciferase control vector were co-transfected
with increasing amounts of plasmid encoding eIF4E. Effects of co-expression of eIF4E were studied. It was
concluded that increased concentration of eIF4E has no significant effect on the translation of leader 2
containing luciferase mRNA whereas expression of leader 4 mRNA was responsive to eIF4E levels (like the
cap-dependent control).
Citations:
Pedersen S. K., Christiansen J., Hansen T. O., Larsen M. R., Nielsen F. C. (2002) Human insulin-like growth factor II leader 2 mediates internal initiation of translation. Biochem. J. 363(Pt 1):37-44
Additional data: http://www.molbio.ku.dk/MolBioPages/abk/PersonalPages/janchr/index.htm
Regions with experimentally determined secondary structures:
A region with the experimentally determined secondary structure:

IRESite 2D Struct Id: 14
Version: 4 Last change: 2008-09-29 21:00:34
Originaly submitted by: Ivana Hrušková Reviewed by: Martin Mokrejš
The function of the 2D structure:
IRES
The 2D structure causes frameshift:
unknown
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents):
200-320
The underlying nucleic acid sequence and structure of the mapped region:



Rendering structure of IGF2 mRNA 121 nt long with energy of -19.59 kcal/mol as calculated by RNAeval using VARNA Java applet with some IRESite improvements. Hold left mouse button to move structure parts, hold right mouse button to move whole structure, use mouse wheel to zoom. Right mouse-click opens a menu to export into JPG/SVG and many other options.

You need a Java-enabled browser to play this game.
Remarks:
Secondary structure of the region 200-321 of the leader 2 was determined (Fig 6B,C). Please note this region
is actually nt 176-296 of the putative mRNA exon annotated in X53038.

The putative secondary structure was defined by bases chemically modified by DMS, kethoxal and CMCT.
There are a few inconsistencies between the results seen in the gel visible in figure 6B and the putative
secondary structure in figure 6C published by Pedersen et al (2002).

In the picture Fig. 6C of putative secondary structure of the 200-322 region there is one nucleotide extra.
The picture shows CCC in position 256-258 instead of just CC. After this correction the opposite and seemingly
complementary 'G' to this extra 'C' moves from stem into a loop region.

Moreover, guanosine in the position 303 seems to be unpaired with U-276 according to the modification with
kethoxal and CMCT as seen in the gel (Fig. 6B) but not marked in the picture 6C of the proposed secondary
structure. Its complementary uridine (in the position 276) is marked as modified with CMCT but there is no
corresponding spot seen in the gel. Maybe, instead an empty circle should have been placed next to G-303.

Two cytosines in 227-228 region are unpaired according to the experiment but in Fig. 6C are shown in
a base-paired region. An alternative in our opinion complying with experimental results the structure would
start 3 nucleotides earlier (leftwards). Thus, the stem would be formed from nucleotides number 224-UCC-226
complemented with 236-GGG-238 as before. Then the loop would be formed from 9 unpaired nucleotides instead
of just 4. This is the structure shown in IRESite.

Another region where Fig. 6C conflicts experimental results is 264-267 and 303-306. Although only the bases
303-306 are annotated as unpaired in Fig. 6C also the bases 264-267 appear unpaired in Fig 6B.

Finally, authors state in Discussion that the "depicted" hairpins are not stable under probing conditions.
By "depicted" they mean actually all those 4 hairpins shown in Fig. 6C, according to pre-last sentence in
Results.



Notes:
1. CMCT modifies the N-3 group of unpaired U residues and the N-1 group of unpaired G residues (Garlapati
et al, 2001). Actual results in the gel in figure 6B show that CMCT modifies only unpaired U residues in this
experiment.

2. It seems that kethoxal modification causes small acceleration of electromobility of fragments being
resolved during the experiment.

3. On the other hand, DMS modification leads to small deceleration of the movement during electrophoresis.
Citations:
Pedersen S. K., Christiansen J., Hansen T. O., Larsen M. R., Nielsen F. C. (2002) Human insulin-like growth factor II leader 2 mediates internal initiation of translation. Biochem. J. 363(Pt 1):37-44
Additional data: http://www.molbio.ku.dk/MolBioPages/abk/PersonalPages/janchr/index.htm
Last change to the database: 2011-04-08 22:43:22 GMT+1