The nucleic acid data:
IRESite Id: 342 Version: 2
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2008-05-20 18:39:15
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  both_UTRs_incomplete
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  Apaf-1
The genetic origin of this natural mRNA/+RNA:
  nuclear
The GenBankId GI:# number of exactly this mRNA/+RNA sequence:
3694812
The mRNA/+RNA description: 
Mus musculus apoptotic protease activating factor 1 mRNA, transcript variant 2
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  guessed_as_the_sequence_was_never_published_by_authors_nor_described_in_sufficient_detail
The organism containing this mRNA with IRES segment in its genome:
Mus musculus Swiss-Webster/NIH
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The total number of notable open-reading frames (ORFs):
  1
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
Apaf-1
The description of the protein encoded in this ORF:
apoptotic protease activating factor
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  586-4302
Remarks:
Current gene models in Gene database for mouse Apaf-1 present 2, alternatively spliced transcripts
(GI:110347464 and GI:110347470). They differ in a region which is optionally spliced out in variant 2. It
appears Coldwell et al. (2000) have used the second splice variant, with the optional intron excised as
they refer in their article to mouse Apaf-1 having 5'-UTR long 585bp (which is the case of GI:3694812) and
which aligns well with the second splice variant GI:110347470. The difference between the original record
GI:3694812 and current model for splice variant 2 is an extension of 5'-UTR by 40 bp at the 5'-extremity.
Below is shown the region with the optional intron (the alignment of 5'-ends of 5'UTRs is in the record with
pRMmAF plasmid annotation IRESiteID:343):

110347464       aactccggtgcaaaggcttggttacacatccggcgctcacacatcctgttgctcgtcatg
3694812         aactccggtgcaaaggcttg----------------------------------------
110347470       aactccggtgcaaaggcttg----------------------------------------
                ********************

110347464       acaggcatcctggtgctttgcctctagcccatgctccacagcgaggagagagaaaaccct
3694812         ---ggcatcctggtgctttgcctctagcccatgctccacagcgaggagagagaaaaccct
110347470       ---ggcatcctggtgctttgcctctagcccatgctccacagcgaggagagagaaaaccct
                   *********************************************************
Citations:
Coldwell M. J., Mitchell S. A., Stoneley M., MacFarlane M., Willis A. E. (2000) Initiation of Apaf-1 translation by internal ribosome entry. Oncogene. 19(7):899-905
IRESs:
IRES:
Version: 1 Last change: 2008-05-20 18:39:15
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  Apaf-1
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1-583
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
It appears only bases 1-583 have been actually cloned into pRMmAF vector. Please refer to the annotation of
the plasmids pRAF and pRMmAF).
Citations:
Coldwell M. J., Mitchell S. A., Stoneley M., MacFarlane M., Willis A. E. (2000) Initiation of Apaf-1 translation by internal ribosome entry. Oncogene. 19(7):899-905
Last change to the database: 2015-04-16 16:45:23 GMT+1