The nucleic acid data:
IRESite Id: 343 Version: 2
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2008-05-22 17:32:23
IRESite record type:
  plasmid_with_promoter_and_putative_IRES_translationally_characterized
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  hopefully_full-length_mRNA
The mRNA/+RNA description: 
Putative spliced in vitro SV40 promoter-derived transcript of pRMmAF plasmid containing mouse version of
putative Apaf-1 IRES except the very last 2 bases of 5'-UTR. However, the 5'-end of the UTR is maybe
incomplete as well (by 39 bp).
The mRNA/+RNA sequence represented in the +DNA notation:


Warning: mRNA sequence when devoid of trailing 'A's is still not a substring of the plasmid sequence. Is it because an intron is spliced out? Stay calm then. :-)
Credibility of mRNA sequence:
  end-to-end_sequence_reverse_engineered_and_should_match_experiment
The name of the plasmid:
pRMmAF
The name of the promoter used to express this mRNA:
  SV40
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
Apaf-1
The origin of IRES in the plasmid:
  nuclear
The donor organism of the IRES segment:
Mus musculus
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pRMmAF.jpg
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 1 Last change: 2008-05-22 17:32:23
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
RLuc
The description of the protein encoded in this ORF:
Renilla luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  192-1127
ORF
ORF position:   2
Version: 2 Last change: 2008-05-22 17:32:23
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
FLuc
The description of the protein encoded in this ORF:
Firefly luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1765-3417
Remarks:
The cloned 5'-UTR is probably not the complete 5'-UTR of Apaf-1. From the note on page 899 in the article that
the UTR is 585 bases long one can gather that GI:3694812 possibly contains the sequence cloned by authors.
Below is shown the 5'-end of mRNAs annotated in GenBank at the moment.

110347464       gtgtggactgggcgggcccagcggtgtttgagtgctccgcggtcctgaggcagagaccag
3694812         ---------------------------------------cgg-cttgaggcagagaccag
110347470       gtgtggactgggcgggcccagcggtgtttgagtgctccgcggtcctgaggcagagaccag
                                                       *** * ***************

We suppose that similarly to the case of pRAF the very last two bases 'ca' of the wild-type 5'-UTR was not
cloned to retain position of the putative IRES 'in frame' with the initiator ATG codon ('CC' bases from
cloning NcoI CCATGG site got into the place instead). This would have been clear if a sequence of the primer
used for cloning would have been published.
Citations:
Coldwell M. J., Mitchell S. A., Stoneley M., MacFarlane M., Willis A. E. (2000) Initiation of Apaf-1 translation by internal ribosome entry. Oncogene. 19(7):899-905
IRESs:
IRES:
Version: 2 Last change: 2008-05-22 17:32:23
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  Apaf-1
The functional status of IRES:
  functional
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1180-1762
How IRES boundaries were determined:
experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  53
3'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  635
5'-end of IRES relative to first base of the START codon of the downstream ORF:
  -585
3'-end of IRES relative to first base of the START codon of the downstream ORF:
  -3
The sequence of IRES region aligned to its secondary structure (if available):


Citations:
Coldwell M. J., Mitchell S. A., Stoneley M., MacFarlane M., Willis A. E. (2000) Initiation of Apaf-1 translation by internal ribosome entry. Oncogene. 19(7):899-905
The translation experiments:
Translation results:
IRESite Translation Id: 415
Version: 2 Last change: 2008-07-09 09:00:29
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The translation method used to study IRES function:
in vivo
The organism used for translation:
Homo sapiens HeLa (ATCC CCL-2)
The temperature (in degrees of Celsia):
37
The relative translation efficiency in % of this IRES:
  371.000
Name of IRES used as the positive control:
  Apaf-1
Name of the plasmid used as the positive control.
pRHRVF
Name of the plasmid used as the negative control.
pRF
IRESite Id of the plasmid used as positive control.
  467
IRESite Id of the plasmid used as negative control.
  184
The relative translation efficiency in % of the positive control:
  100.000
The relative translation efficiency in % of the negative control:
  10.000
The size (length) of intercistronic region in the positive control:
637
The size (length) of intercistronic region in the negative control:
67
The effect of 5'-cap analogs on translation:
not tested
Rapamycin affects translation:
not tested
Type of RNA subject to translation:
  endogenous_nuclear_RNA_Pol_II_transcript
Remarks:
Fig. 3b
Citations:
Coldwell M. J., Mitchell S. A., Stoneley M., MacFarlane M., Willis A. E. (2000) Initiation of Apaf-1 translation by internal ribosome entry. Oncogene. 19(7):899-905
Last change to the database: 2015-04-16 16:45:23 GMT+1