The nucleic acid data:
IRESite Id: 347 Version: 4
Originaly submitted by: Václav Vopálenský
Reviewed by: Martin Mokrejš Last change: 2008-06-04 15:44:56
IRESite record type:
  negative_control_plasmid_with_promoter_and_without_putative_IRES
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  end-to-end_full-length_mRNA
The mRNA/+RNA description: 
In vitro T3 run-off transcript containing firefly luciferase, terminated at NotI site immediately after the
poly(A) tract.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_completely_same_as_in_the_experiment
The name of the plasmid:
pT3LUC-pA
The name of the promoter used to express this mRNA:
  T3
Aliases of the plasmid name:
Alias: T3LUC-pA
Description of the plasmid (facultative for promoter-less plasmid records):
pT3Luc is derived from pRS313 backbone (GI: 58065). It contains T3 promoter site suitable for in vitro transcription/translation assays. Monocistronic RNA, which contains firefly luciferase (Promega), is transcribed by T3 polymerase after vector linearization by NotI. mRNAs transcribed using this vector are bearing poly(A) sequence.
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pT3LUC-pA.jpg
Plasmid sequence verified (partially/completely) by IRESite (more details in Remarks):
  plasmid sequence confirmed by IRESite curators by restriction analysis + parts by PCR + sequencing
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The total number of notable open-reading frames (ORFs):
  1
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 1 Last change: 2008-06-04 12:04:10
Originaly submitted by: Václav Vopálenský Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
FFLuc
The description of the protein encoded in this ORF:
firefly luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  37-1689
Remarks:
IRESite notes about verification of plasmid sequence:

PCR amplification of the sequence encoding monocistronic RNA using M13_reverse (CAGGAAACAGCTATGAC) and
M13_forward (GTAAAACGACGGCCAGT) primers gave one band of expected size. Sequent sequencing of the vector
part's and sequencing of the monocistronic transcription unit using M13_reverse, M13_forward, Fluc_seq_reverse
(AGGAACCAGGGCGTATCTC) and Fluc_seq_forward (GTGGACGAAGTACCGAAAGG) primers resulted in final sequence of
supposed mRNA which was combined with backbone plasmid pRS313 (GI:416308) resulting in final sequence of
pT3Luc. More detailed data are annotated in the Genbank sequence file 1133.gb provided on this page above.
Citations:
Iizuka N., Najita L., Franzusoff A., Sarnow P. (1994) Cap-dependent and cap-independent translation by internal initiation of mRNAs in cell extracts prepared from Saccharomyces cerevisiae. Mol. Cell. Biol. 14(11):7322-7330
Last change to the database: 2015-04-16 16:45:23 GMT+1