The nucleic acid data:
IRESite Id: 357 Version: 3
Originaly submitted by: Václav Vopálenský
Reviewed by: Martin Mokrejš Last change: 2008-06-09 09:56:54
IRESite record type:
  negative_control_plasmid_with_promoter_and_without_putative_IRES
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  end-to-end_full-length_mRNA
The mRNA/+RNA description: 
In vitro T3 run-off transcript transcript containing firefly luciferase (luc version).
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_completely_same_as_in_the_experiment
The name of the plasmid:
pSL200Luc(pA)
The name of the promoter used to express this mRNA:
  T3
Aliases of the plasmid name:
Alias: SL200LA
Alias: SL200L(A)
Alias: pSL200LA
Description of the plasmid (facultative for promoter-less plasmid records):
pSL200 is derived from pBluescript-KS+ backbone (GI: 58065). It contains T3 promoter site suitable for in vitro transcription/translation assays. Monocistronic RNA, which contains firefly luciferase (Promega; luc version of the luciferase gene), is transcribed by T3 polymerase after vector linearization by Ecl136II. mRNAs transcribed using this vector are bearing poly(A) sequence.
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pSL200Luc(pA).jpg
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The total number of notable open-reading frames (ORFs):
  1
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 1 Last change: 2008-06-05 11:22:10
Originaly submitted by: Václav Vopálenský Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
FFluc
The description of the protein encoded in this ORF:
firefly luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  291-1946
Remarks:
IRESite notes about verification of plasmid sequence:

PCR amplification of the sequence encoding monocistronic RNA using M13_reverse (CAGGAAACAGCTATGAC) and
M13_forward (GTAAAACGACGGCCAGT) primers gave one band of expected size. Sequent sequencing of the vector
part's and sequencing of the monocistronic transcription unit using M13_reverse, M13_forward, Fluc_seq_reverse
(AGGAACCAGGGCGTATCTC) and Fluc_seq_forward (GTGGACGAAGTACCGAAAGG) primers resulted in final sequence of
supposed mRNA which was combined with backbone plasmid pBluescript-KS+ (GI: 58065) resulting in final sequence
of pSL200LA. More detailed data are annotated in the Genbank sequence file 1208.gb provided on this page
above.
Citations:
Hundsdoerfer P., Thoma C., Hentze M. W. (2005) Eukaryotic translation initiation factor 4GI and p97 promote cellular internal ribosome entry sequence-driven translation. Proc. Natl. Acad. Sci. U. S. A. 102(38):13421-13426
Last change to the database: 2015-04-16 16:45:23 GMT+1