The nucleic acid data:
IRESite Id: 358 Version: 4
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2008-06-12 16:03:55
IRESite record type:
  plasmid_with_promoter_and_putative_IRES_without_translational_characterization
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  possibly_wrong
The mRNA/+RNA description: 
Putative in vivo spliced transcript of pIRESneo plasmid from CLONTECH with synthetic intron spliced out. The
intron boundaries do not conform the GT-AG consensus.
The mRNA/+RNA sequence represented in the +DNA notation:


Warning: mRNA sequence when devoid of trailing 'A's is still not a substring of the plasmid sequence. Is it because an intron is spliced out? Stay calm then. :-)
Credibility of mRNA sequence:
  reverse_engineered_fragment_and_the_rest_is_a_guess
The name of the plasmid:
pIRESneo
The name of the promoter used to express this mRNA:
  CMV_IE
Aliases of the plasmid name:
Alias: pIRES1neo
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
EMCV-R
The origin of IRES in the plasmid:
  viral
The donor organism of the IRES segment:
Encephalomyocarditis virus Rueckert
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pIRESneo.jpg
The total number of notable open-reading frames (ORFs):
  1
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 1 Last change: 2008-06-04 20:29:03
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
aph
The description of the protein encoded in this ORF:
aminoglycoside-3'-O-phosphotransferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  778-1581
Remarks:
The intron region annotated in Clontech's PT3043-5.pdf does not follow the GT...AG intron consensus sequence.
The restriction site positions shown in the picture seem to be positions of the next base following
immediately after the place of cleavage. The sequence used here is the one from Clontech's website in the file
PT3043-SEQ.pdf from Mar 31 1998. Unfortunately, the document refers to GenBank sequence U89673 from 1997 which
is shorter by 4 bases after the IVS (intron) sequence while having several base
mismatches/insertions/deletions. We hope the sequence from 1998 is more correct. Let us note the sequence
deposited in GenBank contains immediately after the intron region PvuI site due to those extra 4 bases.

The mRNA sequence considered here is probably partly wrong due to the mis-annotated intron region by Clontech
and starts from the putative CMV immediate early promoter transcription start site and continues up to the
very end of BGH poly(A) signal.
Citations:
Rees S., Coote J., Stables J., Goodson S., Harris S., Lee M. G. (1996) Bicistronic vector for the creation of stable mammalian cell lines that predisposes all antibiotic-resistant cells to express recombinant protein. Biotechniques. 20(1):102-4, 106, 108-10
Jackson R. J., Howell M. T., Kaminski A. (1990) The novel mechanism of initiation of picornavirus RNA translation. Trends Biochem. Sci. 15(12):477-483
Jang S. K., Krausslich H. G., Nicklin M. J., Duke G. M., Palmenberg A. C., Wimmer E. (1988) A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. J. Virol. 62(8):2636-2643
Huang M. T., Gorman C. M. (1990) Intervening sequences increase efficiency of RNA 3' processing and accumulation of cytoplasmic RNA. Nucleic Acids Res. 18(4):937-947
IRESs:
IRES:
Version: 3 Last change: 2008-06-04 20:46:02
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  EMCV-R+12_mut
The functional status of IRES:
  functional
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  169-755
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
We consider here the IRES sequence should map against the EMCV Rueckert strain and therefore is annotated
shorter on the left side because 'CG' bases do not align the poly(C) tract of the virus. By aligning the
plasmid against genomic sequence of the Rueckert strain (GenBank accession M81861) the region annotated by
IRESite is extended downstream up to the second ATG codon within EMCV polyprotein CDS region, so the IRES
spans +12nt into the ORF and effectively translation initiates at ATG[13-15] while the ATG[1-3] codon has been
mutated.


Alignment of the IRES cloned into pIRESneo against genomic Ruckert strain sequence is shown below:

pIRESneo        ------------------------------------------------------------
M81861          TTGAAAGCCGGGGGTGGGAGATCCGGATTGCCAGTCTGCTCGATATCGCAGGCTGGGTCC 60


pIRESneo        ------------------------------------------------------------
M81861          GTGACTACCCACTCCCCCTTTCAACGTGAAGGCTACGATAGTGCCAGGGCGGGTACTGCC 120


pIRESneo        ------------------------------------------------------------
M81861          GTAAGTGCCACCCCAAAATAACAACAGACCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC 180


pIRESneo        ------------------------------------------------------------
M81861          CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC 240


pIRESneo        -------------------CCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCC 41
M81861          CCCCCCCCCCCCCCCCCCCCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCC 300
                                   *****************************************

pIRESneo        GCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTGATTTTCCACCATATTGCCGTCTT 101
M81861          GCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTT 360
                ************************************ ***********************

pIRESneo        TTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTC 161
M81861          TTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTC 420
                ************************************************************

pIRESneo        TTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTC 221
M81861          TTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTC 480
                ************************************************************

pIRESneo        TGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCC 281
M81861          TGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCC 540
                ************************************************************

pIRESneo        CACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGG 341
M81861          CACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGG 600
                ************************************************************

pIRESneo        CGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCT 401
M81861          CGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCT 660
                ************************************************************

pIRESneo        CCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGAT 461
M81861          CCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGAT 720
                ************************************************************

pIRESneo        CTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTC 521
M81861          CTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAA-CGTC 779
                ******************************************************* ****

pIRESneo        TAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAAGCTTGCC 581
M81861          TAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCC 839
                *****************************************************  * ***

pIRESneo        ACAACC 587
M81861          ACAACC 845
                ******
Citations:
Rees S., Coote J., Stables J., Goodson S., Harris S., Lee M. G. (1996) Bicistronic vector for the creation of stable mammalian cell lines that predisposes all antibiotic-resistant cells to express recombinant protein. Biotechniques. 20(1):102-4, 106, 108-10
Jackson R. J., Howell M. T., Kaminski A. (1990) The novel mechanism of initiation of picornavirus RNA translation. Trends Biochem. Sci. 15(12):477-483
Jang S. K., Krausslich H. G., Nicklin M. J., Duke G. M., Palmenberg A. C., Wimmer E. (1988) A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. J. Virol. 62(8):2636-2643
Huang M. T., Gorman C. M. (1990) Intervening sequences increase efficiency of RNA 3' processing and accumulation of cytoplasmic RNA. Nucleic Acids Res. 18(4):937-947
Last change to the database: 2015-04-16 16:45:23 GMT+1