The nucleic acid data:
IRESite Id: 359 Version: 3
Originaly submitted by: Tomáš Mašek
Reviewed by: Martin Mokrejš Last change: 2008-06-06 12:36:35
IRESite record type:
  plasmid_with_promoter_and_putative_IRES_translationally_characterized
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  end-to-end_full-length_mRNA
The mRNA/+RNA description: 
Bicistronic RNA encoding B2 and NS´proteins as the first and the second cistron, respectively, with fully
active CSFV IRES inserted between them. Putative T7 promoter-derived transcript transcribed either in vitro or
in vivo in BHK-21 cells infected by recombinant vaccinia virus vTF7-3 containing pXLCSFV1-442.NS.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_reverse_engineered_and_should_match_experiment
The name of the plasmid:
pXLCSFV1-442.NS
The name of the promoter used to express this mRNA:
  T7
Description of the plasmid (facultative for promoter-less plasmid records):
pXLCSFV1-442.NS is a derivative of pXL10S. CSFV IRES corresponding to 1-442 bp of viral genomic RNA has been inserted between the two cistrons using SalI and SnaBI enzymes. The pXLJ0S contains T7 and SP6 promoter sites and is typically used in in vitro transcription/translation assays. Bicistronic RNA, which contains B2 and NS cistrons (GI:214094, GI:21693177), is transcribed by T7 polymerase after vector linearization by EcoRI.
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
CSFV
The origin of IRES in the plasmid:
  viral
The donor organism of the IRES segment:
Classical swine fever virus Alfort/Tuebingen
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pXLCSFV1-442.NS.jpg
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Tomáš Mašek Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
B2
The description of the protein encoded in this ORF:
Xenopus laevis B2 cyclin
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  39-1217
ORF
ORF position:   2
Version: 2 Last change: 2008-06-11 14:28:41
Originaly submitted by: Tomáš Mašek Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
NS
The description of the protein encoded in this ORF:
Truncated form of influenza NS1 protein which is N-terminally fused with 3 amino acids
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1761-2516
Remarks:
IRESite notes about verification of plasmid sequence:
The sequence of pXLCSFV1-442.NS (pXLJ0S respectively) was derived from the pXLJCon sequence which has been
experimentally determined by IRESite curators (please see the IRESite entry 329). The sequence of pXLJ0S
differs from pXLJCon in a creation of SnaBI restriction site at position 4202 of plasmid sequence.  A mutation
in vector backbone at position 2808 is indicated in pXLCSFV1-442.NS .gb file provided by IRESite. This
mutation has been detected by sequencing of pXLJCon, thus it is not clear if it is present in pXLJ0S series as
well.
Citations:
Fletcher S. P., Ali I. K., Kaminski A., Digard P., Jackson R. J. (2002) The influence of viral coding sequences on pestivirus IRES activity reveals further parallels with translation initiation in prokaryotes. RNA. 8(12):1558-1571
IRESs:
IRES:
Version: 2 Last change: 2008-06-11 14:28:41
Originaly submitted by: Tomáš Mašek Reviewed by: Martin Mokrejš
The IRES name:
  CSFV_1-442
The functional status of IRES:
  functional
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1389-1830
How IRES boundaries were determined:
experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  172
3'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  613
5'-end of IRES relative to first base of the START codon of the downstream ORF:
  -372
3'-end of IRES relative to first base of the START codon of the downstream ORF:
  69
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
IRES region displaying full translational activity
Citations:
Fletcher S. P., Ali I. K., Kaminski A., Digard P., Jackson R. J. (2002) The influence of viral coding sequences on pestivirus IRES activity reveals further parallels with translation initiation in prokaryotes. RNA. 8(12):1558-1571
The translation experiments:
Translation results:
IRESite Translation Id: 429
Version: 1 Last change: 2008-07-04 13:29:04
Originaly submitted by: Tomáš Mašek Reviewed by: Martin Mokrejš
The translation method used to study IRES function:
in vitro
The in vitro translation system:
rabbit reticulocytes lysate
The organism used for translation:
The temperature (in degrees of Celsia):
37
The relative translation efficiency in % of this IRES:
  100.000
Name of the plasmid used as the negative control.
pXL0S
IRESite Id of the plasmid used as negative control.
  356
The relative translation efficiency in % of the negative control:
  0
The size (length) of intercistronic region in the negative control:
193
The effect of 5'-cap analogs on translation:
not tested
Rapamycin affects translation:
not tested
Type of RNA subject to translation:
  exogenous_RNA_without_cap_without_polyA_tail
Remarks:
Data from Fig. 3.
Citations:
Fletcher S. P., Ali I. K., Kaminski A., Digard P., Jackson R. J. (2002) The influence of viral coding sequences on pestivirus IRES activity reveals further parallels with translation initiation in prokaryotes. RNA. 8(12):1558-1571
Translation results:
IRESite Translation Id: 430
Version: 1 Last change: 2008-07-04 13:29:04
Originaly submitted by: Tomáš Mašek Reviewed by: Martin Mokrejš
The translation method used to study IRES function:
in vivo
The organism used for translation:
Homo sapiens BHK-21 (ATCC CCL-10)
The temperature (in degrees of Celsia):
37
The relative translation efficiency in % of this IRES:
  100.000
Name of the plasmid used as the negative control.
pXL0S
IRESite Id of the plasmid used as negative control.
  356
The relative translation efficiency in % of the negative control:
  0
The size (length) of intercistronic region in the negative control:
193
The effect of 5'-cap analogs on translation:
not tested
Rapamycin affects translation:
not tested
Type of RNA subject to translation:
  endogenous_cytoplasmic_uncapped_T7_transcript_without_polyA_tail
Remarks:
Data from Fig. 4.
Citations:
Fletcher S. P., Ali I. K., Kaminski A., Digard P., Jackson R. J. (2002) The influence of viral coding sequences on pestivirus IRES activity reveals further parallels with translation initiation in prokaryotes. RNA. 8(12):1558-1571
Translation results:
IRESite Translation Id: 452
Version: 2 Last change: 2008-07-04 13:39:18
Originaly submitted by: Tomáš Mašek Reviewed by: Martin Mokrejš
The translation method used to study IRES function:
in vitro
The in vitro translation system:
rabbit reticulocytes lysate
The organism used for translation:
The temperature (in degrees of Celsia):
37
The relative translation efficiency in % of this IRES:
  100.000
Name of the plasmid used as the negative control.
pXL0S
IRESite Id of the plasmid used as negative control.
  356
The relative translation efficiency in % of the negative control:
  0
The size (length) of intercistronic region in the negative control:
193
The effect of 5'-cap analogs on translation:
not tested
Rapamycin affects translation:
not tested
Type of RNA subject to translation:
  exogenous_RNA_with_GpppG_cap_without_polyA_tail
Remarks:
Data from Figs. 2, 3 and 6 and from Tables 1. and 2.
Citations:
Fletcher S. P., Jackson R. J. (2002) Pestivirus internal ribosome entry site (IRES) structure and function: elements in the 5' untranslated region important for IRES function. J. Virol. 76(10):5024-5033
Regions with experimentally determined secondary structures:
A region with the experimentally determined secondary structure:
IRESite 2D Struct Id: 27
Version: 4 Last change: 2008-07-22 18:25:24
Originaly submitted by: Tomáš Mašek Reviewed by: Martin Mokrejš
The function of the 2D structure:
IRES
The 2D structure causes frameshift:
no
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents):
1389-1780
The underlying nucleic acid sequence and structure of the mapped region:



Remarks:
Secondary structure from Fig. 1 in Kolupaeva et al. 2000. However the structure has been edited to correspond
to the sequence that authors claimed to use and which is used in this IRESite record.

>gb|J04358.2|HCVCGSA
HSP Classical swine fever virus - Alfort/Tuebingen, complete genome
Length=12297

 Score =  200 bits (108),  Expect = 1e-48
 Identities = 118/122 (96%), Gaps = 4/122 (3%)
 Strand=Plus/Plus

Fig. 1     8  AGGTTAG--CTTTCTCGTATACGATATTGGATACACT-AATTTCGATTTGGTCTAGGGCA  64
              |||||||  |||||||||||||||||||||||||||| ||||||||||||||||||||||
IRESite    8  AGGTTAGCTCTTTCTCGTATACGATATTGGATACACTAAATTTCGATTTGGTCTAGGGCA  67

Fig. 1    65  CCCCCTCCAGCGACGGCCGAAATGGGCTAGCCATGCCCATAGTAGGACTAGCAAACGGAG  124
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
IRESite   68  -CCCCTCCAGCGACGGCCGAAATGGGCTAGCCATGCCCATAGTAGGACTAGCAAACGGAG  126

Fig. 1   125  GG  126
              ||
IRESite  127  GG  128
3.1.1. Enzymes used to characterize at least partially the 2D structure.
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 49
The temperature (in degrees of Celsia):
37
The enzymatic method used to determine the 2D structure:
ribonuclease T1
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH
7.50
Li+ [mM]
0
Na+ [mM]
0
K+ [mM]
100.00
Mg2+ [mM]
2.50
Ca2+ [mM]
0
Cl- [mM]
100.00
Tris [mM]
20.00
BSA [mM]
0
HEPES [mM]
0
EGTA [mM]
0
EDTA [mM]
0
cacodylate [mM]
0
Other buffer components and their relative concentrations:
reaction supplemented by 2mM DTT, added 0.015 U/microL (in the absence of 40S) or 0.025 U/microL (in its presence) of T1,
incubation 10 min at 37°C in final volume of 40 microL.
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 50
The temperature (in degrees of Celsia):
37
The enzymatic method used to determine the 2D structure:
ribonuclease V1
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH
7.50
Li+ [mM]
0
Na+ [mM]
0
K+ [mM]
100.00
Mg2+ [mM]
2.50
Ca2+ [mM]
0
Cl- [mM]
100.00
Tris [mM]
20.00
BSA [mM]
0
HEPES [mM]
0
EGTA [mM]
0
EDTA [mM]
0
cacodylate [mM]
0
Other buffer components and their relative concentrations:
reaction supplemented by 2mM DTT, added 0.0007 U/microL (in the absence of 40S) or 0.00105 U/microL (in its presence) of V1,
incubation 10 min at 37°C in final volume of 40 microL.
3.1.2. Chemicals used to characterize at least partially the 2D structure.
Chemical reagent used with its respective buffer:
ss_experiment_with_chemical_id: 22
The temperature (in degrees of Celsia):
30
The chemical reagent used to determine the 2D structure:
DMS
Chemical reagent used with its respective buffer:
Version: 0
pH
7.40
Li+ [mM]
0
Na+ [mM]
0
K+ [mM]
100.00
Mg2+ [mM]
2.00
Ca2+ [mM]
0
Cl- [mM]
0
Tris [mM]
20.00
BSA [mM]
0
HEPES [mM]
0
EGTA [mM]
0
EDTA [mM]
0
cacodylate [mM]
0
Other buffer components and their relative concentrations:
104 mM acetate, 1mM DTT
Chemical reagent used with its respective buffer:
ss_experiment_with_chemical_id: 23
The temperature (in degrees of Celsia):
30
The chemical reagent used to determine the 2D structure:
CMCT
Chemical reagent used with its respective buffer:
Version: 0
pH
7.40
Li+ [mM]
0
Na+ [mM]
0
K+ [mM]
100.00
Mg2+ [mM]
2.00
Ca2+ [mM]
0
Cl- [mM]
0
Tris [mM]
20.00
BSA [mM]
0
HEPES [mM]
0
EGTA [mM]
0
EDTA [mM]
0
cacodylate [mM]
0
Other buffer components and their relative concentrations:
104 mM acetate, 1mM DTT
Citations:
Kolupaeva V. G., Pestova T. V., Hellen C. U. (2000) Ribosomal binding to the internal ribosomal entry site of classical swine fever virus. RNA. 6(12):1791-1807
Sizova D. V., Kolupaeva V. G., Pestova T. V., Shatsky I. N., Hellen C. U. (1998) Specific interaction of eukaryotic translation initiation factor 3 with the 5' nontranslated regions of hepatitis C virus and classical swine fever virus RNAs. J. Virol. 72(6):4775-4782
Kolupaeva V. G., Hellen C. U., Shatsky I. N. (1996) Structural analysis of the interaction of the pyrimidine tract-binding protein with the internal ribosomal entry site of encephalomyocarditis virus and foot-and-mouth disease virus RNAs. RNA. 2(12):1199-1212
Last change to the database: 2015-04-16 16:45:23 GMT+1