The nucleic acid data:
IRESite Id: 374 Version: 0
Originaly submitted by: Václav Vopálenský
Reviewed by: Martin Mokrejš
IRESite record type:
  negative_control_plasmid_with_promoter_and_without_putative_IRES
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  end-to-end_full-length_mRNA
The mRNA/+RNA description: 
mRNA produced by tricistronic plasmid pRG-L666 which comprises DsRED2, L666 and EGFP ORFs. L666 clone was
selected from lambda phage library containing randomly cleaved phage lambda DNA for its low expression in vivo
(see Masek, et al.; 2007; PMID: 17554033).
The sequence ends at its 3'-end right after the poly(A) signal from SV40 mRNA and thus the 3'-UTR might be
slightly wrong.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_completely_same_as_in_the_experiment
The name of the plasmid:
pRL-L666
The name of the promoter used to express this mRNA:
  CMV_IE
Description of the plasmid (facultative for promoter-less plasmid records):
L666 sequence was inserted into intercistronic position of pRG bicistronic plasmid (IRESiteID:369) to create tricistronic control vector. L666 sequence is consisting from two part of lambda DNA (GI:215104): Score = 691 bits (374), Expect = 0.0 Identities = 374/374 (100%), Gaps = 0/374 (0%) Strand=Plus/Plus Query 1 AATTTCAGCCAGTGCCTCGTCCATTTTTTCGATGAACTCCGGCACGATCTCGTCAAAACT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 31378 AATTTCAGCCAGTGCCTCGTCCATTTTTTCGATGAACTCCGGCACGATCTCGTCAAAACT 31437 Query 61 CGCCATGTACTTTTCATCCCGCTCAATCACGACATAATGCAGGCCTTCACGCTTCATACG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 31438 CGCCATGTACTTTTCATCCCGCTCAATCACGACATAATGCAGGCCTTCACGCTTCATACG 31497 Query 121 CGGGTCATAGTTGGCAAAGTACCAGGCATTTTTTCGCGTCACCCACATGCTGTACTGCAC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 31498 CGGGTCATAGTTGGCAAAGTACCAGGCATTTTTTCGCGTCACCCACATGCTGTACTGCAC 31557 Query 181 CTGGGCCATGTAAGCTGACTTTATGGCCTCGAAACCACCGAGCCGGAACTTCATGAAATC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 31558 CTGGGCCATGTAAGCTGACTTTATGGCCTCGAAACCACCGAGCCGGAACTTCATGAAATC 31617 Query 241 CCGGGAGGTAAACGGGCATTTCAGTTCAAGGCCGTTGCCGTCACTGCATAAACCATCGGG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 31618 CCGGGAGGTAAACGGGCATTTCAGTTCAAGGCCGTTGCCGTCACTGCATAAACCATCGGG 31677 Query 301 AGAGCAGGCGGTACGCATACTTTCGTCGCGATAGATGATCGGGGATTCAGTAACATTCAC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 31678 AGAGCAGGCGGTACGCATACTTTCGTCGCGATAGATGATCGGGGATTCAGTAACATTCAC 31737 Query 361 GCCGGAAGTGAATT 374 |||||||||||||| Sbjct 31738 GCCGGAAGTGAATT 31751 Score = 492 bits (266), Expect = 9e-136 Identities = 266/266 (100%), Gaps = 0/266 (0%) Strand=Plus/Minus Query 371 AATTTCCTGATAGTCGTCACCGCGTTTTGCGCACTCTTTCTCGTAGGTACTCAGTCCGGC 430 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4302 AATTTCCTGATAGTCGTCACCGCGTTTTGCGCACTCTTTCTCGTAGGTACTCAGTCCGGC 4243 Query 431 TTCTATCAGCATCACCGCTTCCTGAACTTCTTTCAGACCATCGATGGCCATACGACCGGA 490 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4242 TTCTATCAGCATCACCGCTTCCTGAACTTCTTTCAGACCATCGATGGCCATACGACCGGA 4183 Query 491 GCCTATCCAGTCGCAGTTCCCCCAGGCACTGCGGGCTTCCTGAAAACTGAAGCGCGCTTT 550 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4182 GCCTATCCAGTCGCAGTTCCCCCAGGCACTGCGGGCTTCCTGAAAACTGAAGCGCGCTTT 4123 Query 551 TGAAGGTAACGTCACCACGCGGCGAACGATGGCCTCTTCCAGCCAGCACAGAAACATCTG 610 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4122 TGAAGGTAACGTCACCACGCGGCGAACGATGGCCTCTTCCAGCCAGCACAGAAACATCTG 4063 Query 611 GCTCGCCTGACGGGATGCGACGAATT 636 |||||||||||||||||||||||||| Sbjct 4062 GCTCGCCTGACGGGATGCGACGAATT 4037
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pRL-L666.jpg
Plasmid sequence verified (partially/completely) by IRESite (more details in Remarks):
  plasmid sequence confirmed by IRESite curators by restriction analysis + parts by PCR + sequencing
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The total number of notable open-reading frames (ORFs):
  3
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Václav Vopálenský Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
DsRED2
The description of the protein encoded in this ORF:
red fluorescent protein (DsRed2 version, Clontech)
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  31-726
ORF
ORF position:   2
Version: 0
Originaly submitted by: Václav Vopálenský Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
L666
The description of the protein encoded in this ORF:
arteficial short ORF derived from bacteriophage lambda DNA.
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1080-1298
ORF
ORF position:   3
Version: 0
Originaly submitted by: Václav Vopálenský Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
EGFP
The description of the protein encoded in this ORF:
red-shifted variant of wild-type GFP optimized for brighter fluorescence and higher expression in mammalian cells (Clontech)
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1427-2146
Remarks:
IRESite notes about verification of plasmid sequence:
The complete sequence of L666 region was determined by sequencing using DsRed1-C Sequencing Primer
(Clontech; #6483-1; 5'-AGCTGGACATCACCTCCCACAACG-3').
The plasmid was used as the negative control for experiments in article Hepatitis C virus internal ribosome
entry site initiates protein synthesis at the authentic initiation codon in yeast. (Masek et al., 2007; PMID:
17554033).
Citations:
Masek T., Vopalensky V., Horvath O., Vortelova L., Feketova Z., Pospisek M. (2007) Hepatitis C virus internal ribosome entry site initiates protein synthesis at the authentic initiation codon in yeast. J. Gen. Virol. 88(Pt 7):1992-2002
Last change to the database: 2015-04-16 16:45:23 GMT+1