The nucleic acid data:
IRESite Id: 379 Version: 1
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2008-06-12 03:58:17
IRESite record type:
  plasmid_with_promoter_and_putative_IRES_without_translational_characterization
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  both_UTRs_possibly_incomplete
The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one.
13621323 
The mRNA/+RNA description: 
Putative in vivo transcript of cloning vector pLXRN from Mo-MuLV down to the end of R in right LTR.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  reverse_engineered_fragment_and_the_rest_is_a_guess
The name of the plasmid:
pLXRN
The name of the promoter used to express this mRNA:
  Mo-MuLV_LTR
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
EMCV-R
The origin of IRES in the plasmid:
  viral
The donor organism of the IRES segment:
Encephalomyocarditis virus Rueckert
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pLXRN.jpg
The total number of notable open-reading frames (ORFs):
  1
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
aph
The description of the protein encoded in this ORF:
aminoglycoside-3'-O-phosphotransferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1327-2130
Citations:
Miller A. D., Rosman G. J. (1989) Improved retroviral vectors for gene transfer and expression. Biotechniques. 7(9):980-2, 984-6, 989-90
IRESs:
IRES:
Version: 1 Last change: 2011-04-08 22:26:36
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  EMCV-R_260-845
The functional status of IRES:
  functional
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  717-1303
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
There are several differences compared to the reference EMCV-R IRES region sequence:

>IRESite_Id:140 EMCV-R virus
          Length = 7835

 Score =  975 bits (558), Expect = 0.0
 Identities = 580/590 (98%), Gaps = 7/590 (1%)
 Strand = Plus / Plus


Query: 1   cccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 260 cccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtg 319


Query: 61  tgtgtttgtctatatgtgattttccaccatattgccgtcttttggcaatgtgagggcccg 120
           || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 320 tgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccg 379


Query: 121 gaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaagg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 380 gaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaagg 439


Query: 181 aatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagaca 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 440 aatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagaca 499


Query: 241 aacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcct 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 500 aacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcct 559


Query: 301 ctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgcca 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 560 ctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgcca 619


Query: 361 cgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtagtcaacaa 420
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 620 cgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaa 679


Query: 421 ggggctgaaggatgcccagaaggtaccccattgtatgggaatctgatctggggcctcggt 480
           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 680 ggggctgaaggatgcccagaaggtaccccattgtatggg-atctgatctggggcctcggt 738


Query: 481 gcacatgctttacatgtgtttagtcgaggttaaaaaa-gctctaggccccccgaaccacg 539
           ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||
Sbjct: 739 gcacatgctttacatgtgtttagtcgaggttaaaaaacg-tctaggccccccgaaccacg 797


Query: 540 gggacgtggttttcctttgaaaaacacgatgataagct-t-gccacaacc 587
           |||||||||||||||||||||||||||||||||||  | | |||||||||
Sbjct: 798 gggacgtggttttcctttgaaaaacacgatgataa--tatggccacaacc 845
Last change to the database: 2015-04-16 16:45:23 GMT+1