The nucleic acid data:
IRESite Id: 386 Version: 1
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2008-06-12 16:04:34
IRESite record type:
  plasmid_with_promoter_and_putative_IRES_without_translational_characterization
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  possibly_wrong
The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one.
1899166 
The mRNA/+RNA description: 
Putative in vivo spliced transcript of pIREShyg plasmid from CLONTECH with synthetic intron spliced out. The
intron boundaries do not conform the GT-AG consensus.
The mRNA/+RNA sequence represented in the +DNA notation:


Warning: mRNA sequence when devoid of trailing 'A's is still not a substring of the plasmid sequence. Is it because an intron is spliced out? Stay calm then. :-)
Credibility of mRNA sequence:
  only_fragment_published_or_from_author_and_the_rest_is_a_guess
The name of the plasmid:
pIREShyg
The name of the promoter used to express this mRNA:
  CMV_IE
Aliases of the plasmid name:
Alias: pIRES1hyg
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
EMCV-R
The origin of IRES in the plasmid:
  viral
The donor organism of the IRES segment:
Encephalomyocarditis virus Rueckert
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pIREShyg.jpg
The total number of notable open-reading frames (ORFs):
  1
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
hph
The description of the protein encoded in this ORF:
hygromycin B phosphotransferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  744-1778
Remarks:
The mRNA sequence considered here is probably partly wrong due to the mis-annotated intron region by Clontech
and starts from the putative CMV immediate early promoter transcription start site and continues up to the
very end of BGH poly(A) signal.
Citations:
Rees S., Coote J., Stables J., Goodson S., Harris S., Lee M. G. (1996) Bicistronic vector for the creation of stable mammalian cell lines that predisposes all antibiotic-resistant cells to express recombinant protein. Biotechniques. 20(1):102-4, 106, 108-10
Jackson R. J., Howell M. T., Kaminski A. (1990) The novel mechanism of initiation of picornavirus RNA translation. Trends Biochem. Sci. 15(12):477-483
Jang S. K., Krausslich H. G., Nicklin M. J., Duke G. M., Palmenberg A. C., Wimmer E. (1988) A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. J. Virol. 62(8):2636-2643
Huang M. T., Gorman C. M. (1990) Intervening sequences increase efficiency of RNA 3' processing and accumulation of cytoplasmic RNA. Nucleic Acids Res. 18(4):937-947
IRESs:
IRES:
Version: 1 Last change: 2011-04-08 22:24:46
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  EMCV-R_260-845
The functional status of IRES:
  functional
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  146-732
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
There are several differences to the reference EMCV-R IRES region sequence:


>IRESite_Id:140 EMCV-R virus
          Length = 7835

 Score =  975 bits (558), Expect = 0.0
 Identities = 580/590 (98%), Gaps = 7/590 (1%)
 Strand = Plus / Plus


Query: 1   cccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 260 cccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtg 319


Query: 61  tgtgtttgtctatatgtgattttccaccatattgccgtcttttggcaatgtgagggcccg 120
           || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 320 tgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccg 379


Query: 121 gaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaagg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 380 gaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaagg 439


Query: 181 aatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagaca 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 440 aatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagaca 499


Query: 241 aacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcct 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 500 aacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcct 559


Query: 301 ctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgcca 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 560 ctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgcca 619


Query: 361 cgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtagtcaacaa 420
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 620 cgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaa 679


Query: 421 ggggctgaaggatgcccagaaggtaccccattgtatgggaatctgatctggggcctcggt 480
           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 680 ggggctgaaggatgcccagaaggtaccccattgtatggg-atctgatctggggcctcggt 738


Query: 481 gcacatgctttacatgtgtttagtcgaggttaaaaaa-gctctaggccccccgaaccacg 539
           ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||
Sbjct: 739 gcacatgctttacatgtgtttagtcgaggttaaaaaacg-tctaggccccccgaaccacg 797


Query: 540 gggacgtggttttcctttgaaaaacacgatgataagct-t-gccacaacc 587
           |||||||||||||||||||||||||||||||||||  | | |||||||||
Sbjct: 798 gggacgtggttttcctttgaaaaacacgatgataa--tatggccacaacc 845
Citations:
Rees S., Coote J., Stables J., Goodson S., Harris S., Lee M. G. (1996) Bicistronic vector for the creation of stable mammalian cell lines that predisposes all antibiotic-resistant cells to express recombinant protein. Biotechniques. 20(1):102-4, 106, 108-10
Jackson R. J., Howell M. T., Kaminski A. (1990) The novel mechanism of initiation of picornavirus RNA translation. Trends Biochem. Sci. 15(12):477-483
Jang S. K., Krausslich H. G., Nicklin M. J., Duke G. M., Palmenberg A. C., Wimmer E. (1988) A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. J. Virol. 62(8):2636-2643
Huang M. T., Gorman C. M. (1990) Intervening sequences increase efficiency of RNA 3' processing and accumulation of cytoplasmic RNA. Nucleic Acids Res. 18(4):937-947
Last change to the database: 2015-04-16 16:45:23 GMT+1