The nucleic acid data:
IRESite Id: 39 Version: 24
Originaly submitted by: Tomáš Mašek Submission date: 2005-06-26 00:00:00
Reviewed by: Martin Pospíšek Last change: 2009-08-26 13:35:43
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  end-to-end_full-length_mRNA
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  crTMV
The genetic origin of this natural mRNA/+RNA:
  viral
The GenBankId GI:# number of exactly this mRNA/+RNA sequence:
32309927
The mRNA/+RNA description: 
Crucifer tobamovirus, complete genome.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  guessed_as_the_sequence_was_never_published_by_authors_nor_described_in_sufficient_detail
The organism containing this mRNA with IRES segment in its genome:
Crucifer tobamovirus
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The total number of notable open-reading frames (ORFs):
  4
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 4 Last change: 2009-08-26 13:35:43
Originaly submitted by: Tomáš Mašek Reviewed by: Martin Pospíšek
The abbreviated name of this ORF/gene:
CtVgp1
The description of the protein encoded in this ORF:
RNA replicase read-through protein, 178 kDa
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  yes
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  69-4874
ORF
ORF position:   2
Version: 4 Last change: 2009-08-26 13:35:43
Originaly submitted by: Tomáš Mašek Reviewed by: Martin Pospíšek
The abbreviated name of this ORF/gene:
CtVgp2
The description of the protein encoded in this ORF:
RNA replicase protein, 122kDa
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  yes
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  69-3392
ORF
ORF position:   3
Version: 4 Last change: 2009-08-26 13:35:43
Originaly submitted by: Tomáš Mašek Reviewed by: Martin Pospíšek
The abbreviated name of this ORF/gene:
CtVgp3
The description of the protein encoded in this ORF:
movement protein (MP), 30 kDa
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  4877-5680
ORF
ORF position:   4
Version: 4 Last change: 2009-08-26 13:35:43
Originaly submitted by: Tomáš Mašek Reviewed by: Martin Pospíšek
The abbreviated name of this ORF/gene:
CtVgp4
The description of the protein encoded in this ORF:
coat protein (CP), 17 kDa
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  5604-6077
Remarks:
Both replicase proteins (122 and 178 kDa) are translated from genomic crTMV RNA (Z29370). The movement protein
(MP, 30 kDa) and coat protein (CP, 17 kDa) are translated from two, individual subgenomic RNAs (sgRNAs)
(Ivanov et al., 1997). The uncapped sg I2 RNA functionally encoding only MP has 75bp long 5'-UTR whereas the
sg RNA encoding only CP ORF is capped and had only 9bp long 5'-UTR.

Unexpectedly, the CP protein is also translated from full-length genomic crTMV RNA in which MP and CP ORFs
overlap by 25 codons through IRES. This was shown in in vitro assay using wheat germ cell extracs (Figure 1A
in Ivanov et al., 1997).




In the type member TMV UI (IRESiteId:615) the RdRp proteins are 130 and 183 kDa large. MP (30 kDa) and CP
proteins are translated from two, individual subgenomic RNAs (sgRNAs). Dicistronic uncapped I2 sgRNA codes for
MP and CP proteins but only MP is translated (second cistron encoding CP is silent). Monocistronic capped
sgRNA encodes only the coat protein (CP) (Lehto et al., 1990) and had 9bp long 5'-UTR (Guilley et al., 1979). In
contrast to crTMV no IRES was found in TMV UI in a region preceding the CP ORF. The MP and CP ORFs do not overlap
in TMV UI unlike in crTMV. [see also Ivanov et al., 1997, Figure 1A]


The crTMV IRES of coat protein was characterized in vitro using rabbit reticulocyte lysates, Krebs-2 ascite
cell-free extract and wheat germ extract (WGE). At first, the transcripts used in WGE system contained part of
the viral sequence with MP and CP overlapping coding regions and therefore had no intercistronic region
(Figure 1). Experiments placed IRES CP in its natural context into bicistronic vectors: 1st ORF contained
5'-terminal part of neomycin phosphotransferase ORF followed by IRES CP and the CP ORF itself (Figures 4 and
5). Finally, the crTMV IRES was also placed behind the CP ORF in the intercistronic region while before GUS
(Figures 7 and 8). Integrity of some in vitro transcripts used for RRL in vitro translation system was
verified by agarose gel elecrophoresis of 32P-radiolabelled transcripts back-isolated from the RRL mixture
(Figure 8). [Ivanov et al., 1997]


The sequence shown in Fig. 9 (Ivanov et al., 1997) is slightly different compared to the one deposited
in 2003 by Ryabov into GenBank and based on which this IRESite record is built. The region shown in Fig. 9
is however located between bases 5442-5597 of GI:32309927 (last 3 bases is the ATG codon of CP protein).
On a similar note, the schemas in Fig. 2 of the same publication the start positions of ORFs do not
account for START codons, so the ORFs shown are by 3 bases shorter (replace 4877 with 4874 and 5604 with
5595) and for the C-terminus, replace 6074 with 6068.

Several complete genomes are present in GenBank:
GI:18254496 strain wasabi, isolate Shizuoka, 6298 bp, Lee et al.
GI:18146768 strain wasabi, isolate Tochigi, 6297 bp, Lee et al.
GI:18146763 strain wasabi, isolate Shizuoka, 6298 bp, Lee et al.
GI:32309927, 6304 bp, Ryabov et al. (2003)
GI:488713, 6312bp, Dorokhov et al. (1994) <----- used for this IRESite record
patent GI:33005674, 227 bp, Ryabov et al. (Sequence 1 from patent US 6376745)
patent GI:33005675, 79 bp, Ryabov et al. (Sequence 2 from patent US 6376745)


We cannot find the GC-rich TBS sequence (98bp long 5'-UTR preceding the CP ORF) shown in Figure 2G (Ivanov et
al., 1997) neither in the crTMV RNA under accession number Z29370 nor in GenBank nonred-nt database (which is
worry-some). The crTMV IRES sequence with predicted secondary structure is shown in Figure 6. of the same
article and matches the Z29370 record sequence.

Based on the raw sequencing data of intercistronic regions of hCP-H-GUS, hGFP-H-GUS, GFP-H-GUS, one can
confirm a single-point mutation in the 5'-UTR sequence of sgI2 RNA (-3 to -75 relative to AUG codon of MP
of crTMV) which is present in all these single-sequencing reads. Probably the Z29370 crTMV genomic sequence
contains a mistake (isolated and sequenced by the same scientific group):

Z29370   ttcgtttgctttttgtagtataattaaatatttgtcagataagagattgtttagagatttgttctttgtttgataATGTCGATAGTTTCG
plasmids   cgtttgctttttgtagtataattaaatatttgtcagataagagattggttagagatttgttctttgtttga
                                                          ^
Citations:
Ivanov P. A., Karpova O. V., Skulachev M. V., Tomashevskaya O. L., Rodionova N. P., Dorokhov YuL, Atabekov J. G. (1997) A tobamovirus genome that contains an internal ribosome entry site functional in vitro. Virology. 232(1):32-43
Dorokhov YuL, Ivanov PA, Novikov VK, Agranovsky AA, Morozov SYu, Efimov VA, Casper R, Atabekov JG (1994) Complete nucleotide sequence and genome organization of a tobamovirus infecting cruciferae plants. FEBS Lett. 1(350):5-8
Guilley H, Jonard G, Kukla B, Richards KE (1979) Sequence of 1000 nucleotides at the 3' end of tobacco mosaic virus RNA. Nucleic Acids Res. 4(6):1287-1308
Lehto K, Grantham GL, Dawson WO (1990) Insertion of sequences containing the coat protein subgenomic RNA promoter and leader in front of the tobacco mosaic virus 30K ORF delays its expression and causes defective cell-to-cell movement. Virology. 1(174):145-157
IRESs:
IRES:
Version: 17 Last change: 2009-08-26 13:35:43
Originaly submitted by: Tomáš Mašek Reviewed by: Martin Pospíšek
The IRES name:
  crTMV_IREScp
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  5456-5601
Conclusion:
  strongly_supported_IRES
How IRES boundaries were determined:
experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  582
3;-end of IRES relative to last base of the STOP codon of the upstream ORF:
  727
5'-end of IRES relative to first base of the START codon of the downstream ORF:
  -148
3'-end of IRES relative to first base of the START codon of the downstream ORF:
  -3
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
In vitro translation of uncapped TBSMPCP plasmid transcripts which contained presumed TBS stem loop in front
of the first cistron with MP protein revealed that only the protein from second citron (CP protein) was
produced (Figure 3A in Ivanov et al., 1997).

Here is annotated as the IRES region a stretch of 148 bp immediately preceding the ATG codon of CP protein
(see also Figure 6 in the article). Deletion of either 5'- terminal 113 nt or 3'-terminal 35 nt of this IRES
sequence abrogates IRES activity in vitro (Fig. 5). The results suggest functionality of CrTMV IRES in vitro.
The 148 bp region has a good consensus in crucifer-infecting Tobamoviruses (crTMV, TVCV, TMV-Cg lines in
Figure 9) while differs in the other Tobamoviruses. The 148 bp long sequence in type member TMV UI virus lacks
the observed IRES activity of crTMV strain (Fig. 9, TMV UI shown as "TMV").

It is not known from results of Ivanov what is the ratio between IRES mediated translation of CP from genomic
RNA and translation from capped CP sgRNA in vivo. It was observed in vitro that efficiency of translation of
CP protein from monocistronic constructs was higher than that from bicistronic TBSMPCP transcript where
ribosomal movement is impaired by the secondary structure of TBS GC-rich loop.

Results of Toth et al. (2001) in plant protoplasts using PVX-based expression vector show that the IRES-driven
translation is about 24x weaker (Table 2). Interestingly, they also showed that the IRES is functional also in
reverse orientation and that placement of a stable hairpin dowsntream of the IRES blocks translation of the
downstream cistron and that placement of the hairpin upstream of the IRES halved translation of the downstream
cistron.




Skulachev et al. (1999) studied this IRES (148bp long) of the coat protein in the context of yet another
putative IRES in front of the movement protein ORF (228bp long). In vivo tests involved tobacco protoplasts
expressing the bicistronic transcripts using the 35S promoter. In comparison with monocistronic transcripts
both IREScp and IRESmp were about 20-70x weaker in protoplasts. In vitro RRL and WGE were used with constructs
utilizing CP and MP reporters but also CP followed by GUS, GFP by obelin and luc by GUS.
Citations:
Ivanov P. A., Karpova O. V., Skulachev M. V., Tomashevskaya O. L., Rodionova N. P., Dorokhov YuL, Atabekov J. G. (1997) A tobamovirus genome that contains an internal ribosome entry site functional in vitro. Virology. 232(1):32-43
Toth RL, Chapman S, Carr F, Santa Cruz S (2001) A novel strategy for the expression of foreign genes from plant virus vectors. FEBS Lett. 2(489):215-219
Skulachev MV, Ivanov PA, Karpova OV, Korpela T, Rodionova NP, Dorokhov YL, Atabekov JG (1999) Internal initiation of translation directed by the 5'-untranslated region of the tobamovirus subgenomic RNA I(2). Virology. 1(263):139-154
IRES:
Version: 3 Last change: 2009-08-26 13:35:43
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  crTMV_IRESmp75
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  4802-4876
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  1410
3;-end of IRES relative to last base of the STOP codon of the upstream ORF:
  1484
5'-end of IRES relative to first base of the START codon of the downstream ORF:
  -75
3'-end of IRES relative to first base of the START codon of the downstream ORF:
  -1
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
Dorokhov et al. (2002) studied both crTMV IRESs also in transgenic tobacco plants, in HeLa cells and some
yeast strain where he scaled the IRESs to the EMCV-R IRES.
Citations:
Skulachev MV, Ivanov PA, Karpova OV, Korpela T, Rodionova NP, Dorokhov YL, Atabekov JG (1999) Internal initiation of translation directed by the 5'-untranslated region of the tobamovirus subgenomic RNA I(2). Virology. 1(263):139-154
Dorokhov YL, Skulachev MV, Ivanov PA, Zvereva SD, Tjulkina LG, Merits A, Gleba YY, Hohn T, Atabekov JG (2002) Polypurine (A)-rich sequences promote cross-kingdom conservation of internal ribosome entry. Proc. Natl. Acad. Sci. U.S.A. 8(99):5301-5306
IRES:
Version: 3 Last change: 2009-08-26 13:35:43
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  crTMV_IRESmp228
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  4649-4876
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  1257
3;-end of IRES relative to last base of the STOP codon of the upstream ORF:
  1484
5'-end of IRES relative to first base of the START codon of the downstream ORF:
  -228
3'-end of IRES relative to first base of the START codon of the downstream ORF:
  -1
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
The MP IRES can be shortened from 228bp to just 75bp. Surprisingly also in the Tobamovirus type member TMV UI
genome was revealed equivalent to this one in front of MP gene (same 228bp-sized region tested).
Citations:
Skulachev MV, Ivanov PA, Karpova OV, Korpela T, Rodionova NP, Dorokhov YL, Atabekov JG (1999) Internal initiation of translation directed by the 5'-untranslated region of the tobamovirus subgenomic RNA I(2). Virology. 1(263):139-154
Last change to the database: 2010-03-03 23:22:41 GMT+1