The nucleic acid data:
IRESite Id: 413 Version: 2
Originaly submitted by: Václav Vopálenský
Reviewed by: Martin Mokrejš Last change: 2008-06-24 21:57:26
IRESite record type:
  plasmid_with_promoter_and_putative_IRES_translationally_characterized
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  end-to-end_full-length_mRNA
The mRNA/+RNA description: 
In vitro T3 run-off transcript produced from bicistronic plasmid pRML-p(A) which comprises renilla and firefly
luciferases as the first and the second cistron, respectively and the 5' UTR of human c-myc (nt from -407 to
-2) mRNA transcribed from major P2 promoter. These mRNAs are bearing a poly(A) tail.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_completely_same_as_in_the_experiment
The name of the plasmid:
pRML-p(A)
The name of the promoter used to express this mRNA:
  T3
Description of the plasmid (facultative for promoter-less plasmid records):
Plasmid containing 5' UTR of human c-myc transcribed from major P2 promoter (nt from -407 to -2) inserted between renilla and firefly luciferase reporter genes, with the poly(A)tract.
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
c-myc
The origin of IRES in the plasmid:
  nuclear
The donor organism of the IRES segment:
Homo sapiens HeLa (ATCC CCL-2)
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pRML-p(A).jpg
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Václav Vopálenský Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
RLuc
The description of the protein encoded in this ORF:
renilla luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  57-992
ORF
ORF position:   2
Version: 0
Originaly submitted by: Václav Vopálenský Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
FFLuc
The description of the protein encoded in this ORF:
firefly luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1416-3071
Remarks:
IRESite notes about verification of plasmid sequence:
PCR amplification of the sequence encoding bicistronic RNA using M13_reverse (CAGGAAACAGCTATGAC) and
M13_forward (GTAAAACGACGGCCAGT) primers gave one band of expected size.
Sequent sequencing of the vector part's and sequencing of the bicistronic transcription unit using
M13_reverse, M13_forward, Fluc_seq_reverse (AGGAACCAGGGCGTATCTC), Fluc_seq_forward (GTGGACGAAGTACCGAAAGG) and
Rluc_seq_rev (CTGCATGTTTTTCTGAATC) primers resulted in final sequence of supposed mRNA which was in silico
combined with backbone plasmid pBluescript-KS+ (GI: 58065) resulting in the final sequence of vector presented
here in IRESite. More detailed data are annotated in the Genbank sequence file 1343.gb provided on this page
above.
Citations:
Thoma C., Bergamini G., Galy B., Hundsdoerfer P., Hentze M. W. (2004) Enhancement of IRES-mediated translation of the c-myc and BiP mRNAs by the poly(A) tail is independent of intact eIF4G and PABP. Mol. Cell. 15(6):925-935
IRESs:
IRES:
Version: 0
Originaly submitted by: Václav Vopálenský Reviewed by: Martin Mokrejš
The IRES name:
  c-myc
The functional status of IRES:
  functional
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1008-1414
How IRES boundaries were determined:
experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  16
3'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  422
5'-end of IRES relative to first base of the START codon of the downstream ORF:
  -408
3'-end of IRES relative to first base of the START codon of the downstream ORF:
  -2
The sequence of IRES region aligned to its secondary structure (if available):


Citations:
Thoma C., Bergamini G., Galy B., Hundsdoerfer P., Hentze M. W. (2004) Enhancement of IRES-mediated translation of the c-myc and BiP mRNAs by the poly(A) tail is independent of intact eIF4G and PABP. Mol. Cell. 15(6):925-935
The translation experiments:
Translation results:
IRESite Translation Id: 464
Version: 3 Last change: 2008-07-08 09:11:25
Originaly submitted by: Václav Vopálenský Reviewed by: Martin Mokrejš
The translation method used to study IRES function:
in vitro
The in vitro translation system:
HeLa cell lysate
The organism used for translation:
The temperature (in degrees of Celsia):
37
The relative translation efficiency in % of this IRES:
  100.000
Name of the plasmid used as the negative control.
pRML
IRESite Id of the plasmid used as negative control.
  410
The relative translation efficiency in % of the negative control:
  14.100
The size (length) of intercistronic region in the negative control:
423
The effect of 5'-cap analogs on translation:
no
Rapamycin affects translation:
not tested
Type of RNA subject to translation:
  exogenous_RNA_with_GpppG_cap_with_polyA_tail
Remarks:
Whereas the cap-dependent translation of the 5' cistron (RLuc) in the bicistronic reporter mRNAs is strongly
inhibited by adding 7mGpppG analog, the c-myc IRES-driven translation of the 3' cistron (FFLuc) is not
significantly affected. By contrast, addition of ApppG, cap analog that does not bind the translation
initiation factor eIF4E, does not significantly impair translation from either cistron.

The translation of c-myc.IRES-pA RNA is about 7-fold higher efficient than the translation of the
non-polyadenylated counterpart c-myc.IRES RNA (IRESId: 410).

Translational data are derived from Table 1.
Citations:
Thoma C., Bergamini G., Galy B., Hundsdoerfer P., Hentze M. W. (2004) Enhancement of IRES-mediated translation of the c-myc and BiP mRNAs by the poly(A) tail is independent of intact eIF4G and PABP. Mol. Cell. 15(6):925-935
Last change to the database: 2015-04-16 16:45:23 GMT+1