The nucleic acid data:
IRESite Id: 414 Version: 1
Originaly submitted by: Václav Vopálenský
Reviewed by: Martin Mokrejš Last change: 2008-06-20 14:20:03
IRESite record type:
  plasmid_with_promoter_and_putative_IRES_without_translational_characterization
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  hopefully_full-length_mRNA
The mRNA/+RNA description: 
In vitro T3 run-off transcript produced from bicistronic plasmid pSL-RML which comprises renilla and firefly
luciferases as the first and the second cistron, respectively and the 5' UTR of human c-myc (nt from -407 to
-2) mRNA transcribed from major P2 promoter. A stable stem-loop structure was inserted just behind the T3
promoter close to the 5' end of the first cistron of a bicistronic mRNA.These mRNAs are lacking a poly(A)
tail.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_reverse_engineered_and_should_match_experiment
The name of the plasmid:
pSL-RML
The name of the promoter used to express this mRNA:
  T3
Description of the plasmid (facultative for promoter-less plasmid records):
Plasmid containing 5' UTR of human c-myc transcribed from major P2 promoter (nt from -407 to -2) inserted between renilla and firefly luciferase reporter genes, without the poly(A)tract. A synthetic DNA fragment (5' CCCGGAGCGCCCAGATCTGGGCGCTCCGGGGTAC 3') was inserted into the bicistronic c-myc constructs to introduce a stable stemloop structure (deltaG = - 243 kJ/mol) 19 nts downstream from transcription start site.
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
c-myc
The origin of IRES in the plasmid:
  nuclear
The donor organism of the IRES segment:
Homo sapiens HeLa (ATCC CCL-2)
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


Plasmid sequence verified (partially/completely) by IRESite (more details in Remarks):
  part of the yet unknown plasmid sequence determined by IRESite curators
GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pSL-RML.jpg
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Václav Vopálenský Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
RLuc
The description of the protein encoded in this ORF:
renilla luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  91-1026
ORF
ORF position:   2
Version: 0
Originaly submitted by: Václav Vopálenský Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
FFluc
The description of the protein encoded in this ORF:
firefly luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1450-3105
Remarks:
The plasmid was used as the control for experiments in article Enhancement of IRES-Mediated Translation of the
c-myc and BiP mRNAs by the Poly(A) Tail Is Independent of Intact eIF4G and PABP (Thoma et al., 2004; PMID:
15383282).
Citations:
Thoma C., Bergamini G., Galy B., Hundsdoerfer P., Hentze M. W. (2004) Enhancement of IRES-mediated translation of the c-myc and BiP mRNAs by the poly(A) tail is independent of intact eIF4G and PABP. Mol. Cell. 15(6):925-935
IRESs:
IRES:
Version: 0
Originaly submitted by: Václav Vopálenský Reviewed by: Martin Mokrejš
The IRES name:
  c-myc
The functional status of IRES:
  functional
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1042-1448
How IRES boundaries were determined:
experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  16
3'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  422
5'-end of IRES relative to first base of the START codon of the downstream ORF:
  -408
3'-end of IRES relative to first base of the START codon of the downstream ORF:
  -2
The sequence of IRES region aligned to its secondary structure (if available):


Citations:
Thoma C., Bergamini G., Galy B., Hundsdoerfer P., Hentze M. W. (2004) Enhancement of IRES-mediated translation of the c-myc and BiP mRNAs by the poly(A) tail is independent of intact eIF4G and PABP. Mol. Cell. 15(6):925-935
Last change to the database: 2015-04-16 16:45:23 GMT+1