The nucleic acid data:
IRESite Id: 457 Version: 3
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2009-09-01 21:43:52
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  our_best_guess
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  p27kip1
The genetic origin of this natural mRNA/+RNA:
  nuclear
The GenBankId GI:# number of exactly this mRNA/+RNA sequence:
17978497
Synonyms of the gene name:
Synonym: KIP1
Synonym: CDKN1B
Synonym: MEN4
Synonym: CDKN4
Synonym: MEN1B
The mRNA/+RNA description: 
Homo sapiens cyclin-dependent kinase inhibitor 1B (p27, Kip1) (CDKN1B), mRNA. Poly(A)-tail sequence was
dropped.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  guessed_as_the_sequence_was_never_published_by_authors_nor_described_in_sufficient_detail
The organism containing this mRNA with IRES segment in its genome:
Homo sapiens
A promoter reported in cDNA corresponding to IRES sequence:
  no
The total number of notable open-reading frames (ORFs):
  1
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
not_tested
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
heterogeneous_population_of_molecules_found
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
not_tested
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Homo sapiens
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
CDKN1B
The description of the protein encoded in this ORF:
cyclin-dependent kinase inhibitor 1B
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  466-1062
Remarks:
The sequence used in IRESite was obtained from IRESdb database to which it has been provided by S. Pyronnet.
Although the sequence appears to be an incomplete mRNA sequence when aligned to current GenBank RefSeq record
the base #1 of the query is the first base of the transcript as determined by primer extension (Minami et al.
(1997):

>NM_004064.2 Homo sapiens cyclin-dependent kinase inhibitor 1B (p27, Kip1) (CDKN1B), mRNA
Length=2422

 GENE ID: 1027 CDKN1B | cyclin-dependent kinase inhibitor 1B (p27, Kip1)
[Homo sapiens] (Over 100 PubMed links)

 Score =  281 bits (152),  Expect = 2e-75
 Identities = 154/155 (99%), Gaps = 0/155 (0%)
 Strand=Plus/Plus

Query  1    GGGCCGTGGCTCGTCGGGGTCAGTGTCTTTTGGCTCCGAGGGCAGTCGCTGGGCTTCCGA  60
            ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct  314  GGGCCGTGGCTCGTCGGGGTCTGTGTCTTTTGGCTCCGAGGGCAGTCGCTGGGCTTCCGA  373

Query  61   GAGGGGTTCGGGCCGCGTAGGGGCGCtttgttttgttcggttttgtttttttgAGAGTGC  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  374  GAGGGGTTCGGGCCGCGTAGGGGCGCTTTGTTTTGTTCGGTTTTGTTTTTTTGAGAGTGC  433

Query  121  GAGAGAGGCGGTCGTGCAGACCCGGGAGAAAGATG  155
            |||||||||||||||||||||||||||||||||||
Sbjct  434  GAGAGAGGCGGTCGTGCAGACCCGGGAGAAAGATG  468

The transcription start site of mouse p27kip1 is 23 bp upstream of the one from human (Minami et al. (1997),
Figure 5.

A human sequence with just 153 bp long 5'-UTR is GI:9652559.
Citations:
Minami S., Ohtani-Fujita N., Igata E., Tamaki T., Sakai T. (1997) Molecular cloning and characterization of the human p27Kip1 gene promoter. FEBS. Lett. 411(1):1-6
IRESs:
IRES:
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  p27kip1
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  314-465
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Last change to the database: 2015-04-16 16:45:23 GMT+1