The nucleic acid data:
IRESite Id: 467 Version: 6
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2008-12-16 02:44:15
IRESite record type:
  plasmid_with_promoter_and_putative_IRES_translationally_characterized
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  our_best_guess
The mRNA/+RNA description: 
Putative spliced bicistronic transcript derived from SV40 promoter based pRHRVF plasmid.
The mRNA/+RNA sequence represented in the +DNA notation:


Warning: mRNA sequence when devoid of trailing 'A's is still not a substring of the plasmid sequence. Is it because an intron is spliced out? Stay calm then. :-)
Credibility of mRNA sequence:
  reverse_engineered_sequence_and_should_match_experiment_maybe_except_3UTR
The name of the plasmid:
pRHRVF
The name of the promoter used to express this mRNA:
  SV40
The in vivo produced transcripts are heterogeneous (due to any of promoter?/splicing?/cleavage?/breakage?):
  not tested
The in vivo produced heterogeneous transcripts occur due to alternative splicing:
  not tested
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The abbreviated name of the donor gene or virus from which this IRES was excised and inserted into the plasmid:
HRV2
The origin of IRES in the plasmid:
  viral
The donor organism of the IRES segment:
Human rhinovirus 2
The DNA sequence of the plasmid in (+) orientation annotated by its secondary structure:


GenBank formatted file with annotated plasmid sequence hyperlinked from vector image map:
pRHRVF.jpg
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 1 Last change: 2008-07-12 17:27:16
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
RLuc
The description of the protein encoded in this ORF:
Renilla luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  192-1127
ORF
ORF position:   2
Version: 1 Last change: 2008-07-12 17:27:16
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
FLuc
The description of the protein encoded in this ORF:
Firefly luciferase
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1766-3418
Remarks:
The sequence of this plasmid was provided by K. Spriggs. Following is the alignment to the complete genome
sequence as determined originally by Skern et al. (1985). It is unclear when the mutations were acquired
and whether they are authentic at all. Definitely, the sequence of this plasmid differs from the similarly
named plasmid pR-HRV-F (IRESite_Id:228 and IRESite_Id:232 -- both records are based on the same plasmid
sequence, just SV40 and T7-based transcripts). This plasmid sequence from K. Spriggs lacks some regions
present in pR-HRV-F.

The pR-HRV-F plasmid contains the in-frame AUG codon which is found in HRV genome in position 449 whereas
the polyprotein AUG is located at position 611 so in theory the polyprotein produced could be much larger.
In contrast, this pRHRVF construct has some single nucleotide insertion since the AUG449 so there appears
UAG STOP codon (if this is not a mistake in the sequence we have received) which interrupts that reading
frame (uORF size 54bp in total) overlapping the IRES. BTW, there are several uORFs in HRV 5'-UTR anyway.
It is not clear whether this could make any difference in experiments (probably not).


>X02316.1 Human rhinovirus 2, complete sequence
Length=7102

 Score = 1046 bits (566),  Expect = 0.0
 Identities = 574/577 (99%), Gaps = 3/577 (0%)
 Strand=Plus/Plus

pRHRVF 1    GATCCAGGTTGTTCCCACCTGGATTTCCCACAGGGAGTGGTACTCTGTTATTACGGTAAC  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
X02316 10   GATCCAGGTTGTTCCCACCTGGATTTCCCACAGGGAGTGGTACTCTGTTATTACGGTAAC  69

pRHRVF 61   TTTGTACGCCAGTTTTATCTCCCTTCCCCCATG-AACTTAGAAGTTTTTCACAAAAGACC  119
            ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||
X02316 70   TTTGTACGCCAGTTTTATCTCCCTTCCCCCATGTAACTTAGAAGTTTTTCAC-AAAGACC  128

pRHRVF 120  AATAGCCGGTAATCAGCCAGATTACTGAAGGTCAAGCACTTCTGTTTCCCCGGTCAATGT  179
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
X02316 129  AATAGCCGGTAATCAGCCAGATTACTGAAGGTCAAGCACTTCTGTTTCCCCGGTCAATGT  188

pRHRVF 180  TGATATGCTCCAACAGGGCAAAAACAACTGCGATCGTTAACCGCAAAGCGCCTACGCAAA  239
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
X02316 189  TGATATGCTCCAACAGGGCAAAAACAACTGCGATCGTTAACCGCAAAGCGCCTACGCAAA  248

pRHRVF 240  GCTTAGTAGCATCTTTGAAATCGTTTGGCTGGTCGATCCGCCATTTCCCCTGGTAGACCT  299
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
X02316 249  GCTTAGTAGCATCTTTGAAATCGTTTGGCTGGTCGATCCGCCATTTCCCCTGGTAGACCT  308

pRHRVF 300  GGCAGATGAGGCTAGAAATACCCCACTGGCGACAGTGTTCTAGCCTGCGTGGCTGCCTGC  359
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
X02316 309  GGCAGATGAGGCTAGAAATACCCCACTGGCGACAGTGTTCTAGCCTGCGTGGCTGCCTGC  368

pRHRVF 360  ACACCCTATGGGTGTGAAGCCAAACAATGGACAAGGTGTGAAGAGCCCCGTGTGCTCGCT  419
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
X02316 369  ACACCCTATGGGTGTGAAGCCAAACAATGGACAAGGTGTGAAGAGCCCCGTGTGCTCGCT  428

pRHRVF 420  TTGAGTCCTCCGGCCCCTGAATGTGGCTAACCTTAACCCTGGCAGCTAGAGCACGTAACC  479
            ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
X02316 429  TTGAGTCCTCCGGCCCCTGAATGTGGCTAACCTTAACCCTG-CAGCTAGAGCACGTAACC  487

pRHRVF 480  CAATGTGTATCTAGTCGTAATGAGCAATTGCGGGATGGGACCAACTACTTTGGGTGTCCG  539
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
X02316 488  CAATGTGTATCTAGTCGTAATGAGCAATTGCGGGATGGGACCAACTACTTTGGGTGTCCG  547

pRHRVF 540  TGTTTCACTTTTTCCTTTATATTTGCTTATGGTGACAGTACC---------------------ATG
            |||||||||||||||||||||||||||||||||||||
X02316 548  TGTTTCACTTTTTCCTTTATATTTGCTTATGGTGACAATATATACAATATATATATTGGCACCATG


Probably more important is the difference between both plasmids just in front of the initiator AUG (so at
the IRES 3'-end boundary):

pRHRVF        TTTCACTTTTTCCTTTATATTTGCTTATGGTGACAGTACC---------------------ATG
pR-HRV-F      TTTCACTTTCTCCTTTATATTTGCTTATGGTGACAATATATACAATATATATATTGGCACCATG
Citations:
Stoneley M., Subkhankulova T., Le Quesne J. P., Coldwell M. J., Jopling C. L., Belsham G. J., Willis A. E. (2000) Analysis of the c-myc IRES; a potential role for cell-type specific trans-acting factors and the nuclear compartment. Nucleic Acids Res. 28(3):687-694
IRESs:
IRES:
Version: 2 Last change: 2008-07-12 17:27:16
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  HRV-2
The functional status of IRES:
  functional
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1185-1760
How IRES boundaries were determined:
experimentally_determined
5'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  58
3'-end of IRES relative to last base of the STOP codon of the upstream ORF:
  633
5'-end of IRES relative to first base of the START codon of the downstream ORF:
  -581
3'-end of IRES relative to first base of the START codon of the downstream ORF:
  -6
The sequence of IRES region aligned to its secondary structure (if available):


Citations:
Stoneley M., Subkhankulova T., Le Quesne J. P., Coldwell M. J., Jopling C. L., Belsham G. J., Willis A. E. (2000) Analysis of the c-myc IRES; a potential role for cell-type specific trans-acting factors and the nuclear compartment. Nucleic Acids Res. 28(3):687-694
The translation experiments:
Translation results:
IRESite Translation Id: 511
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The translation method used to study IRES function:
in vivo
The organism used for translation:
Homo sapiens HeLa (ATCC CCL-2)
The temperature (in degrees of Celsia):
37
The relative translation efficiency in % of this IRES:
  51.000
Name of IRES used as the positive control:
  EMCV-R
Name of the plasmid used as the positive control.
pREMCVF
Name of the plasmid used as the negative control.
pRF
IRESite Id of the plasmid used as positive control.
  349
IRESite Id of the plasmid used as negative control.
  184
The relative translation efficiency in % of the positive control:
  100.000
The relative translation efficiency in % of the negative control:
  2.500
The size (length) of intercistronic region in the positive control:
619
The size (length) of intercistronic region in the negative control:
67
The effect of 5'-cap analogs on translation:
not tested
Rapamycin affects translation:
not tested
Type of RNA subject to translation:
  endogenous_nuclear_RNA_Pol_II_transcript
Remarks:
Data from Figure 2B.
Citations:
Coldwell M. J., deSchoolmeester M. L., Fraser G. A., Pickering B. M., Packham G., Willis A. E. (2001) The p36 isoform of BAG-1 is translated by internal ribosome entry following heat shock. Oncogene. 20(30):4095-4100
Translation results:
IRESite Translation Id: 517
Version: 1 Last change: 2008-07-08 19:30:06
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The translation method used to study IRES function:
in vivo
The organism used for translation:
Homo sapiens HeLa (ATCC CCL-2)
The temperature (in degrees of Celsia):
37
The relative translation efficiency in % of this IRES:
  67.000
Name of IRES used as the positive control:
  EMCV-R
Name of the plasmid used as the positive control.
pREMCVF
Name of the plasmid used as the negative control.
pRF
IRESite Id of the plasmid used as positive control.
  349
IRESite Id of the plasmid used as negative control.
  184
The relative translation efficiency in % of the positive control:
  100.000
The relative translation efficiency in % of the negative control:
  11.000
The size (length) of intercistronic region in the positive control:
619
The size (length) of intercistronic region in the negative control:
67
The effect of 5'-cap analogs on translation:
not tested
Rapamycin affects translation:
not tested
Type of RNA subject to translation:
  endogenous_nuclear_RNA_Pol_II_transcript
Remarks:
Data from Figure 5.
Citations:
Stoneley M., Subkhankulova T., Le Quesne J. P., Coldwell M. J., Jopling C. L., Belsham G. J., Willis A. E. (2000) Analysis of the c-myc IRES; a potential role for cell-type specific trans-acting factors and the nuclear compartment. Nucleic Acids Res. 28(3):687-694
Last change to the database: 2015-04-16 16:45:23 GMT+1