The nucleic acid data:
IRESite Id: 55 Version: 4
Originaly submitted by: Václav Vopálenský Submission date: 2005-07-29 00:00:00
Reviewed by: Václav Vopálenský Last change: 2010-01-12 21:46:05
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  our_best_guess
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  n-MYC
The genetic origin of this natural mRNA/+RNA:
  nuclear
The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one.
62750358 
Synonyms of the gene name:
Synonym: NMYC
Synonym: ODED
Synonym: MODED
Synonym: MYCN
The mRNA/+RNA description: 
Homo sapiens v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) (MYCN), mRNA.
Poly(A) tail dropped.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  only_fragment_published_or_from_author_and_the_rest_is_a_guess
The organism containing this mRNA with IRES segment in its genome:
Homo sapiens
A promoter reported in cDNA corresponding to IRES sequence:
  no
The total number of notable open-reading frames (ORFs):
  1
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
not_tested
Integrity (uniformity) of mRNA tested using RNase protection:
homogeneous_population_of_molecules_confirmed
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
not_tested
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
not_tested
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Homo sapiens HeLa (ATCC CCL-2)
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 3 Last change: 2009-09-01 17:19:12
Originaly submitted by: Václav Vopálenský Reviewed by: Václav Vopálenský
The abbreviated name of this ORF/gene:
n-myc
The description of the protein encoded in this ORF:
v-myc myelocytomatosis viral related oncogene, neuroblastoma derived
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  301-1695
Remarks:
Integrity of the bicistronic transcript in transiently transfected cells was tested by RNase-protection assay.
The GenBank underlying sequence is possibly shorter on the 5'-end when compared to the clone used by authors.



The sequence IRESite used for this record (NM_005378.4) does not align well to mRNA entry. Note the seemingly
overly long 5'-UTR we have which could be spanning into a promoter region and that most of this region belongs
to the IRES:

>gb|BC002712.2| UniGene infoGeoGene info Homo sapiens v-myc myelocytomatosis viral related oncogene,
neuroblastoma derived (avian), mRNA (cDNA clone MGC:3962 IMAGE:3627330),
complete cds
Length=2458

 Score = 4481 bits (2426),  Expect = 0.0
 Identities = 2430/2432 (99%), Gaps = 0/2432 (0%)
 Strand=Plus/Plus

Query  182   AGTGTTGGAGGTCGGCGCCGGCCCCCGCCTTCCGCGCCCCCCACGGGAAGGAAGCACCCC  241
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  23    AGTGTTGGAGGTCGGCGCCGGCCCCCGCCTTCCGCGCCCCCCACGGGAAGGAAGCACCCC  82

[cut]



A hit to a full-length cDNA (by oligo-capping) shows this entry has an extra exon(s) or the exon is extended:

>dbj|AK298225.1| UniGene infoGene info Homo sapiens cDNA FLJ51262 complete cds, highly similar to N-myc
proto-oncogene protein
Length=2015

Query  1    GTCATCTGTCTGGACGCGCTGGGTGGATGCGGGGGGCTCCTGGGAACTGTGTTGGAGCCG  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4    GTCATCTGTCTGGACGCGCTGGGTGGATGCGGGGGGCTCCTGGGAACTGTGTTGGAGCCG  63

[cut]

Query  361  TTTGACTCGCTACAGCCCTGCTTCTACCCGGACGAAGATGACTTCTACTTCGG-CGGCCC  419
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct  364  TTTGACTCGCTACAGCCCTGCTTCTACCCGGACGAAGATGACTTCTACTTCGGTCG-CCC  422

Query  420  C  420
            |
Sbjct  423  C  423

[cut]

Query  999   ggTCGCCCCTCCGCGCCCAGGCGGCCGCCAGACCAGCGGCGGCGACCACAAGGCCCTCAG  1058
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  415   GGTCGCCCCTCCGCGCCCAGGCGGCCGCCAGACCAGCGGCGGCGACCACAAGGCCCTCAG  474

[cut]

Query  2559  TTGAAATACCTCATGTTTATGAAAATAAATAGCTTAAAATT  2599
             |||||||||||||||||||||||||||||||||||||||||
Sbjct  1975  TTGAAATACCTCATGTTTATGAAAATAAATAGCTTAAAATT  2015



More information on the various exons in entries: M13241, X03295, X02363, X03919.
Citations:
Jopling C. L., Willis A. E. (2001) N-myc translation is initiated via an internal ribosome entry segment that displays enhanced activity in neuronal cells. Oncogene. 20(21):2664-2670
IRESs:
IRES:
Version: 4 Last change: 2008-06-26 02:14:16
Originaly submitted by: Václav Vopálenský Reviewed by: Václav Vopálenský
The IRES name:
  n-MYC
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  8-327
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
n-myc UTR (293 nt) and putative open reading frame (27 nt). Please refer also to GI:11692795.
Citations:
Jopling C. L., Willis A. E. (2001) N-myc translation is initiated via an internal ribosome entry segment that displays enhanced activity in neuronal cells. Oncogene. 20(21):2664-2670
Last change to the database: 2015-04-16 16:45:23 GMT+1