The nucleic acid data:
IRESite Id: 574 Version: 7
Originaly submitted by: Martin Mokrejš Submission date: 2009-03-22 18:28:57
Reviewed by: Martin Mokrejš Last change: 2009-10-13 13:22:20
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  hopefully_full-length_mRNA
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  eIF4GII
The genetic origin of this natural mRNA/+RNA:
  nuclear
The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one.
115529454 
Synonyms of the gene name:
Synonym: eIF4G2
The mRNA/+RNA description: 
Eukaryotic translation initiation factor 4 gamma, isoform II, long. Poly(A)-tail sequence was dropped.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_reverse_engineered_and_should_match_experiment
The organism containing this mRNA with IRES segment in its genome:
Homo sapiens
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The total number of notable open-reading frames (ORFs):
  1
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
eIF4GII
The description of the protein encoded in this ORF:
Eukaryotic translation initiation factor 4 gamma, isoform II.
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  612-5369
Remarks:
This sequence encompasses the region studied by Johannes and Sarnow (1998) and named eIF4GII-long. The region
they studied as the 5'-UTR is located in this transcript between 288-614.

To assemble sequence of this entry curator IRESite extended at the 5'-end sequence of NM_003760.3 by 30 bp
long GGAGGCGGCCACAGCGCCATGTTGGATGCT sequence inferred from these ESTs: CN402456 DA260816. This record is
further supported by ESTs: DB451482, DB449034, CN402457, BU155832, BQ644097, DR002014, BF897694, BF897695.

An EST record with accession BD644097 is somewhat different inside the 5'-UTR region and could represent yet
another splice variant of eIF4GII.

Please note the RefSeq entry NM_003760 was not listed in the Supplementary Figure 12 of Baranick et al. (2008)
nor Byrd et al. (2005). That is probably because this gene is on chromosome 1 while their variants are from
chromosome 3.

Our extended mRNA sequence using ESTs in this entry spans in front of the genomic contig NC_000001:

>NC_000001 Homo sapiens chromosome 1, GRCh37 primary reference assembly.; LEN=370369
>IRESite_Id:574 eIF4GII-long (chromosome1); LEN=6205

1-126  (31-156)                100% -> (GT/AG) 24   (126bp exon)
490-673  (157-340)             100% -> (GT/AG) 24   (184bp exon)
87635-87710  (341-416)         100% -> (GT/AG) 24   (76bp exon)
125854-125982  (417-545)       100% -> (GT/AG) 24   (129bp exon)

>NT_004610 Homo sapiens chromosome 1 genomic contig, GRCh37 reference primary assembly.; LEN=16558170
>IRESite_Id:574 eIF4GII-long (chromosome1); LEN=6205

(complement)

[cut]
8057447-8057575  (5661-5789)   100% <- (GT/AG) 24   (129bp exon)
8095719-8095794  (5790-5865)   100% <- (GT/AG) 24   (76 bp exon)
8182756-8182939  (5866-6049)   100% <- (GT/AG) 24   (184bp exon)
8183303-8183458  (6050-6205)   100%                 (156bp exon)
Citations:
Johannes G., Sarnow P. (1998) Cap-independent polysomal association of natural mRNAs encoding c-myc, BiP, and eIF4G conferred by internal ribosome entry sites. RNA. 4(12):1500-1513
IRESs:
IRES:
Version: 3 Last change: 2009-10-13 13:41:30
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  eIF4GII-long
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  288-614
Conclusion:
  never_claimed_to_be_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
Actually this region (325bp) was never claimed to harbor an IRES and has no IRES activity. In Figure 8 is
shown that eIF4GII-long performed badly in comparison with eIG4GI-ext and especially with PV IRES.
Citations:
Johannes G., Sarnow P. (1998) Cap-independent polysomal association of natural mRNAs encoding c-myc, BiP, and eIF4G conferred by internal ribosome entry sites. RNA. 4(12):1500-1513
Last change to the database: 2015-04-16 16:45:23 GMT+1