The nucleic acid data:
IRESite Id: 583 Version: 7
Originaly submitted by: Martin Mokrejš Submission date: 2009-04-14 12:26:37
Reviewed by: Martin Mokrejš Last change: 2009-09-01 21:57:33
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  our_best_guess
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  LamB1
The genetic origin of this natural mRNA/+RNA:
  nuclear
The GenBankId GI:# number of exactly this mRNA/+RNA sequence:
167614503
The mRNA/+RNA description: 
Homo sapiens laminin, beta 1 (LamB1), mRNA. Poly(A)-tail sequence was dropped.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_reverse_engineered_and_should_match_experiment
The organism containing this mRNA with IRES segment in its genome:
Homo sapiens HeLa (ATCC CCL-2)
A promoter reported in cDNA corresponding to IRES sequence:
  unclear
The total number of notable open-reading frames (ORFs):
  1
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
not_tested
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
not_tested
Integrity (uniformity) of mRNA tested using RT-PCR:
unclear_result
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
unclear_result
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
unclear_result
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Mus musculus MIM-R
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
LamB1
The description of the protein encoded in this ORF:
laminin B1 precursor
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  336-5696
Remarks:
Petz et al. (2007) initially cloned 5'-UTR 474bp long of an unspliced message which sequence was used for the
BLAST search shown below.


>gb|AC078853.9| Gene info Homo sapiens BAC clone RP11-443I10 from 7, complete sequence
Length=4727

 GENE ID: 3912 LAMB1 | laminin, beta 1 [Homo sapiens] (Over 10 PubMed links)

 Score =  859 bits (465),  Expect = 0.0
 Identities = 471/474 (99%), Gaps = 0/474 (0%)
 Strand=Plus/Minus

Query  1     GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGACTCGGCTTTCAAACAAAAGAGG  60
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct  1933  GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGG  1874

Query  61    CGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGGCCGCCCGCCC  120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1873  CGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGGCCGCCCGCCC  1814

Query  121   CTTCAGCCCCGGCTCTCCGTATGCGCATGAGCAGAGGCGCCTCCCTCTGTTCCTCCCAAG  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1813  CTTCAGCCCCGGCTCTCCGTATGCGCATGAGCAGAGGCGCCTCCCTCTGTTCCTCCCAAG  1754

Query  181   GCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCG  240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1753  GCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCG  1694

Query  241   CGTCGCCGGGTGAGGAGAACAAAGTGGCTGCACGATTTTCCCCCCTTTCCAGCCCACCCC  300
             ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct  1693  CGTCGCCGGGTGAGGAGAACAAAGTGGCTGCACGATTTTCCCCACTTTCCAGCCCACCCC  1634

Query  301   CCGCTTCCGTGGGAGCGACAGGAAATGGAAGGGCGCCTCTTCTCTCTTTGAACATTTGCC  360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1633  CCGCTTCCGTGGGAGCGACAGGAAATGGAAGGGCGCCTCTTCTCTCTTTGAACATTTGCC  1574

Query  361   TTTTTTcccccccTTTCCACCTCTCCAGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTC  420
             |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1573  TTTTTTCCCCTCCTTTCCACCTCTCCAGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTC  1514

Query  421   GGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC  474
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1513  GGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC  1460


>gb|M58147.1|HUMLAMBA01  Human laminin B1 chain gene, exons 1 and 2
Length=1588

 Score =  859 bits (465),  Expect = 0.0
 Identities = 471/474 (99%), Gaps = 0/474 (0%)
 Strand=Plus/Plus

Query  1     GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGACTCGGCTTTCAAACAAAAGAGG  60
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct  1070  GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGG  1129

Query  61    CGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGGCCGCCCGCCC  120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1130  CGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGGCCGCCCGCCC  1189

Query  121   CTTCAGCCCCGGCTCTCCGTATGCGCATGAGCAGAGGCGCCTCCCTCTGTTCCTCCCAAG  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1190  CTTCAGCCCCGGCTCTCCGTATGCGCATGAGCAGAGGCGCCTCCCTCTGTTCCTCCCAAG  1249

Query  181   GCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCG  240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1250  GCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCG  1309

Query  241   CGTCGCCGGGTGAGGAGAACAAAGTGGCTGCACGATTTTCCCCCCTTTCCAGCCCACCCC  300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1310  CGTCGCCGGGTGAGGAGAACAAAGTGGCTGCACGATTTTCCCCCCTTTCCAGCCCACCCC  1369

Query  301   CCGCTTCCGTGGGAGCGACAGGAAATGGAAGGGCGCCTCTTCTCTCTTTGAACATTTGCC  360
             ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1370  CCGCTTCCGTGGGAGAGACAGGAAATGGAAGGGCGCCTCTTCTCTCTTTGAACATTTGCC  1429

Query  361   TTTTTTcccccccTTTCCACCTCTCCAGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTC  420
             |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1430  TTTTTTCCCCTCCTTTCCACCTCTCCAGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTC  1489

Query  421   GGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC  474
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1490  GGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC  1543


>gb|M55378.1|HUMLAMB01  Human laminin B1 gene, exons 1 and 2
Length=1597

 Score =  828 bits (448),  Expect = 0.0
 Identities = 472/482 (97%), Gaps = 8/482 (1%)
 Strand=Plus/Plus

Query  1     GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGACTCGGCTTTCAAACAAAAGAGG  60
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct  1071  GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGG  1130

Query  61    CGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGGCCGCCCGCCC  120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1131  CGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGGCCGCCCGCCC  1190

Query  121   CTTCAGCCCCGGCTCTCCGTATGCGCATGAGCAGAGGCGCCTCCCTCTGTTCCTCCCAAG  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1191  CTTCAGCCCCGGCTCTCCGTATGCGCATGAGCAGAGGCGCCTCCCTCTGTTCCTCCCAAG  1250

Query  181   GCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCG  240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1251  GCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCG  1310

Query  241   CGTCGCCGGGTGAGGAG---A--A---CAAAGTGGCTGCACGATTTTCCCCCCTTTCCAG  292
             |||||||||||||||||   |  |   |||||||||||||||||||||||||||||||||
Sbjct  1311  CGTCGCCGGGTGAGGAGGTGAGGAGAACAAAGTGGCTGCACGATTTTCCCCCCTTTCCAG  1370

Query  293   CCCACCCCCCGCTTCCGTGGGAGCGACAGGAAATGGAAGGGCGCCTCTTCTCTCTTTGAA  352
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1371  CCCACCCCCCGCTTCCGTGGGAGCGACAGGAAATGGAAGGGCGCCTCTTCTCTCTTTGAA  1430

Query  353   CATTTGCCTTTTTTcccccccTTTCCACCTCTCCAGAAAGGAAGACGGGAAGAAAGGGCA  412
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct  1431  CATTTGCCTTTTTTCCCCTCCTTTCCACCTCTCCAGAAAGGAAGACGGGAAGAAAGGGCA  1490

Query  413   GGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCG  472
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1491  GGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCG  1550

Query  473   GC  474
             ||
Sbjct  1551  GC  1552


>NM_002291.2 Homo sapiens laminin, beta 1 (LAMB1), mRNA
Length=5866

 GENE ID: 3912 LAMB1 | laminin, beta 1 [Homo sapiens] (Over 10 PubMed links)

 Score =  455 bits (246),  Expect = 1e-124
 Identities = 248/249 (99%), Gaps = 0/249 (0%)
 Strand=Plus/Plus

Query  1    GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGACTCGGCTTTCAAACAAAAGAGG  60
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct  1    GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGG  60

Query  61   CGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGGCCGCCCGCCC  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  61   CGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGGCCGCCCGCCC  120

Query  121  CTTCAGCCCCGGCTCTCCGTATGCGCATGAGCAGAGGCGCCTCCCTCTGTTCCTCCCAAG  180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  121  CTTCAGCCCCGGCTCTCCGTATGCGCATGAGCAGAGGCGCCTCCCTCTGTTCCTCCCAAG  180

Query  181  GCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCG  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  181  GCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCG  240

Query  241  CGTCGCCGG  249
            |||||||||
Sbjct  241  CGTCGCCGG  249


 Score =  161 bits (87),  Expect = 2e-36
 Identities = 87/87 (100%), Gaps = 0/87 (0%)
 Strand=Plus/Plus

Query  388  GAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCC  447
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  249  GAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCC  308

Query  448  GCGTCCCCGTGGCTGCAGGGAGCCGGC  474
            |||||||||||||||||||||||||||
Sbjct  309  GCGTCCCCGTGGCTGCAGGGAGCCGGC  335


Please note the RefSeq record NM_002291.2 used for this IRESite record claims the exons are 1-249,388-474 of
that unspliced message (a DNA contamination?). We conclude actually transcribed are only as exons positions
181-249, 388-474 which is NOT consistent with the RefSeq record.

A search through NCBI NonRed using the putative LamB1 IRES sequence (335bp) as postulated by Petz et al.
(2007) being same as the RefSeq record in it's 5'-UTR:
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGG
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGG
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGG
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGG
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGG
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGG
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGG
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGGC
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGGCC
GCCCGCCCCTTCAGCCCCGGCTCTCCGTATGCGCATGAGCAGAGGCGCCTCCCTCTGTTCCTCCCAAGGCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGA
GCAGGGCGAGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGG
GCAGGGCGAGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGG
GCAGGGCGAGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC
gave the following notable partial hits (note the alignment shown below does not start at position 1 of the query
but is at base 1 of the target hit):
>BC052598.1 Homo sapiens cDNA clone IMAGE:4135495, containing frame-shift errors
Length=2822
 GENE ID: 3912 LAMB1 | laminin, beta 1 [Homo sapiens] (Over 10 PubMed links)

 Score =  302 bits (163),  Expect = 9e-79
 Identities = 163/163 (100%), Gaps = 0/163 (0%)
 Strand=Plus/Plus

Query  173  CTCCCAAGGCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCG  232
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1    CTCCCAAGGCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCG  60

Query  233  AGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCT  292
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  61   AGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCT  120

Query  293  TCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC  335
            |||||||||||||||||||||||||||||||||||||||||||
Sbjct  121  TCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC  163


>BC044633.1 Homo sapiens laminin, beta 1, mRNA (cDNA clone IMAGE:4889995),
containing frame-shift errors
Length=2822

 GENE ID: 3912 LAMB1 | laminin, beta 1 [Homo sapiens] (Over 10 PubMed links)

 Score =  302 bits (163),  Expect = 9e-79
 Identities = 163/163 (100%), Gaps = 0/163 (0%)
 Strand=Plus/Plus

Query  173  CTCCCAAGGCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCG  232
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1    CTCCCAAGGCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCG  60

Query  233  AGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCT  292
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  61   AGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCT  120

Query  293  TCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC  335
            |||||||||||||||||||||||||||||||||||||||||||
Sbjct  121  TCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC  163


>AK307611.1 Homo sapiens cDNA, FLJ97559
Length=5273

 GENE ID: 3912 LAMB1 | laminin, beta 1 [Homo sapiens] (Over 10 PubMed links)

 Score =  287 bits (155),  Expect = 3e-74
 Identities = 155/155 (100%), Gaps = 0/155 (0%)
 Strand=Plus/Plus

Query  181  GCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCG  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1    GCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCG  60

Query  241  CGTCGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACT  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  61   CGTCGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACT  120

Query  301  CCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC  335
            |||||||||||||||||||||||||||||||||||
Sbjct  121  CCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC  155


>M61916.1 Human laminin B1 chain mRNA, complete cds
Length=5613

 GENE ID: 3912 LAMB1 | laminin, beta 1 [Homo sapiens] (Over 10 PubMed links)

 Score =  217 bits (117),  Expect = 3e-53
 Identities = 117/117 (100%), Gaps = 0/117 (0%)
 Strand=Plus/Plus

Query  219  CCCGGAGCAGGGCGAGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGG  278
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1    CCCGGAGCAGGGCGAGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGG  60

Query  279  CTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC  335
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  61   CTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC  117


>AK303501.1 Homo sapiens cDNA FLJ52150 complete cds, moderately similar to Laminin beta-1 chain precursor
Length=996

 GENE ID: 3912 LAMB1 | laminin, beta 1 [Homo sapiens] (Over 10 PubMed links)

 Score =  281 bits (152),  Expect = 1e-72
 Identities = 152/152 (100%), Gaps = 0/152 (0%)
 Strand=Plus/Plus

Query  184  AAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCGCGT  243
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4    AAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCGCGT  63

Query  244  CGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCT  303
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  64   CGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCT  123

Query  304  CTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC  335
            ||||||||||||||||||||||||||||||||
Sbjct  124  CTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC  155


>AK309921.1 Homo sapiens cDNA, FLJ99962
Length=2516

 GENE ID: 3912 LAMB1 | laminin, beta 1 [Homo sapiens] (Over 10 PubMed links)

 Score =  281 bits (152),  Expect = 1e-72
 Identities = 152/152 (100%), Gaps = 0/152 (0%)
 Strand=Plus/Plus

Query  184  AAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCGCGT  243
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2    AAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCGCGT  61

Query  244  CGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCT  303
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  62   CGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCT  121

Query  304  CTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC  335
            ||||||||||||||||||||||||||||||||
Sbjct  122  CTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC  153



Similarly, a search for full-length cDNA of LamB1 using the 5'-UTR determined by Petz et al (2007)
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGG
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGG
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGG
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGG
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGG
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGG
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGG
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGGC
GGGACCTGGAAGCGCCCCAGCCCCGCAGCGATCGCAGATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGGCC
GCCCGCCCCTTCAGCCCCGGCTCTCCGTATGCGCATGAGCAGAGGCGCCTCCCTCTGTTCCTCCCAAGGCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGA
GCAGGGCGAGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGC
gave the following hits (plus a lot more ESTs originating at about position 198 as well or further downstream):
>emb|BX474256.1| UniGene info DKFZp686I19168_r1 686 (synonym: hlcc3) Homo sapiens cDNA clone DKFZp686I19168 5',
mRNA sequence. Length=602  Score =  248 bits (134),  Expect = 1e-62  Identities = 137/138 (99%), Gaps = 1/138 (0%)
 Strand=Plus/Plus
Query  199  CTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCGCGTCGCCGGAAAGGAAGA  258
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2    CTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCGCGTCGCCGGAAAGGAAGA  61

Query  259  CGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGT  318
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  62   CGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGT  121

Query  319  GGCTG-CAGGGAGCCGGC  335
            ||||| ||||||||||||
Sbjct  122  GGCTGGCAGGGAGCCGGC  139


>emb|BX473949.1| UniGene info DKFZp686E24166_r1 686 (synonym: hlcc3) Homo sapiens cDNA clone
DKFZp686E24166 5', mRNA sequence.
Length=509

 Score =  241 bits (130),  Expect = 2e-60
 Identities = 130/130 (100%), Gaps = 0/130 (0%)
 Strand=Plus/Plus

Query  206  GGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAG  265
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1    GGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAG  60

Query  266  AAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCA  325
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  61   AAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCA  120

Query  326  GGGAGCCGGC  335
            ||||||||||
Sbjct  121  GGGAGCCGGC  130


>emb|AL710200.1| UniGene info DKFZp686M1167_r1 686 (synonym: hlcc3) Homo sapiens cDNA clone
DKFZp686M1167 5', mRNA sequence.
Length=642

 Score =  241 bits (130),  Expect = 2e-60
 Identities = 130/130 (100%), Gaps = 0/130 (0%)
 Strand=Plus/Plus

Query  206  GGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAG  265
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2    GGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAG  61

Query  266  AAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCA  325
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  62   AAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCA  121

Query  326  GGGAGCCGGC  335
            ||||||||||
Sbjct  122  GGGAGCCGGC  131


>emb|AL701539.1| UniGene info DKFZp686L15144_r1 686 (synonym: hlcc3) Homo sapiens cDNA clone
DKFZp686L15144 5', mRNA sequence.
Length=425

 Score =  237 bits (128),  Expect = 3e-59
 Identities = 129/130 (99%), Gaps = 0/130 (0%)
 Strand=Plus/Plus

Query  206  GGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAG  265
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1    GGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAG  60

Query  266  AAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCA  325
            |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct  61   AAAGGGCAGGCGGCTCGGCGGGCGTCTTNTCCACTCCTCTGCCGCGTCCCCGTGGCTGCA  120

Query  326  GGGAGCCGGC  335
            ||||||||||
Sbjct  121  GGGAGCCGGC  130



In summary, it is questionable whether the region 1-174 if not 1-197 is a part of promoter or not. However, it
is not supported by any EST nor full-length cDNA data.


The experiments utilizing pGem-based vectors aimed to rule out presence of a cryptic promoter. The pGem
plasmid contains only T7 (in sense with FLuc) and SP6 promoters (in antisense). However, there is no
eukaryotic transcription terminator (the poly(A) signal). One can just hypothesize based on the genome
replication of SV40 and polioma viruses that concatenated transcripts encompassing (e.g. 6-8 full-length
genomic chunks would be produced) could have been detected in case there was a cryptic promoter in front of
the FLuc CDS (Petz et al. (2007), Figure 4A). The sequence of both pGem-based vector was provided directly by
M. Petz (pGem-F IRESite_ID:587, pGem-LamB1-F IRESite_Id:588).

RT-PCR analysis shown in Figure 4C has revealed 2 or 3 faint alternatively spliced transcripts but it has to
be kept in mind that this RT-PCR does not have to catch all types of aberrant transcripts and definitely may
not be misinterpreted in a way that if there are any aberrant transcripts there would be minor. A Northern
blot result would be interesting for overall picture.

However, the activity of pLamB1-F (IRESite_Id:591) monocistronic transcript was 8x higher of EMCV IRES.
Citations:
Petz M., Kozina D., Huber H., Siwiec T., Seipelt J., Sommergruber W., Mikulits W. (2007) The leader region of Laminin B1 mRNA confers cap-independent translation. Nucleic Acids Res. 35(8):2473-2482
IRESs:
IRES:
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  LamB1_-335_-1
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1-335
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Citations:
Petz M., Kozina D., Huber H., Siwiec T., Seipelt J., Sommergruber W., Mikulits W. (2007) The leader region of Laminin B1 mRNA confers cap-independent translation. Nucleic Acids Res. 35(8):2473-2482
Last change to the database: 2015-04-16 16:45:23 GMT+1