The nucleic acid data:
IRESite Id: 59 Version: 4
Originaly submitted by: Zuzana Feketová Submission date: 2005-08-05 00:00:00
Reviewed by: Martin Mokrejš Last change: 2008-06-26 00:38:37
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  end-to-end_full-length_mRNA
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  PSIV
The genetic origin of this natural mRNA/+RNA:
  viral
The GenBankId GI:# number of exactly this mRNA/+RNA sequence:
20451012
The mRNA/+RNA description: 
Plautia stali intestine virus (Dicistroviridae), complete genome
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  guessed_as_the_sequence_was_never_published_by_authors_nor_described_in_sufficient_detail
The organism containing this mRNA with IRES segment in its genome:
Plautia stali intestine virus
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 5 Last change: 2008-05-01 21:18:21
Originaly submitted by: Zuzana Feketová Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
PSIVgp1
The description of the protein encoded in this ORF:
Nonstructural protein precursor. Computer analysis revealed that the aminoacid sequence of ORF1 contains core motifs of picornaviral 2C RNA helicase, 3C cysteine protease and 3D RNA dependent RNA polymerase.
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  571-6006
ORF
ORF position:   2
Version: 5 Last change: 2008-05-01 21:18:21
Originaly submitted by: Zuzana Feketová Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
PSIVgp2
The description of the protein encoded in this ORF:
The capsid protein precursor contains coding regions of four capsid proteins: 33, 30, 26, 4.5 kDa. Coding regions of these proteins were mapped by determination of their N-terminal sequences.
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  yes
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  6193-8628
Remarks:
IRES is a part of the intergenic region of the genome and extends slightly into ORF2 which starts with CAA
codon (Gln). The sequence directly submitted by authors is GI:2344756.
Citations:
Sasaki J., Nakashima N. (1999) Translation Initiation at the CUU Codon Is Mediated by the Internal Ribosome Entry Site of an Insect Picorna-Like Virus In Vitro. J. Virol. 73(2):1219-1226
Sasaki J., Nakashima N., Saito H., Noda H. (1998) An Insect Picorna-like Virus, Plautia stali Intestine Virus, Has Genes of Capsid Proteins in the 3' Part of the Genome. Virology. 244:50-58
IRESs:
IRES:
Version: 10 Last change: 2009-08-29 23:49:59
Originaly submitted by: Zuzana Feketová Reviewed by: Martin Mokrejš
The IRES name:
  PSIV_IGR
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  6002-6146
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
Several studies showed secondary and also 3D structure of the IRES (see the references below). Refer also to
PDB:2IL9 entry. Notably, alignment of the sequence deposited in IRESite reveals that we probably picked up
not the best matching genomic sequence:


>IRESite_Id:59 PSIV_IGR virus
          Length = 8797

 Score =  200 bits (114), Expect = 2e-52
 Identities = 136/150 (90%), Gaps = 13/150 (8%)
 Strand = Plus / Plus


2IL9:  1    gctgactatgtgatcttattaaaattaggttaaatttcgaggttaaaaatagttttaata 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6002 gctgactatgtgatcttattaaaattaggttaaatttcgaggttaaaaatagttttaata 6061


2IL9:  61   ttgctatagtcttagaggtcttgcga-a-----agcttaccacacaagatggaccggagc 114
            |||||||||||||||||||||||  | |     | |||||||||||||||||||||||||
Sbjct: 6062 ttgctatagtcttagaggtcttg-tatatttata-cttaccacacaagatggaccggagc 6119


2IL9:  115  gaaag--ctccaatatctagtgtaccctcg 142
               ||  |||||||||||||||||||||||
Sbjct: 6120 ---agccctccaatatctagtgtaccctcg 6146
Citations:
Sasaki J., Nakashima N. (1999) Translation Initiation at the CUU Codon Is Mediated by the Internal Ribosome Entry Site of an Insect Picorna-Like Virus In Vitro. J. Virol. 73(2):1219-1226
Sasaki J., Nakashima N. (2000) Methionine-independent initiation of translation in the capsid protein of an insect RNA virus. PNAS. 97(4):1512-1515
Kanamori Y., Nakashima N. (2001) A tertiary structure model of the internal ribosome entry site (IRES) for methionine-independent initiation of translation. RNA. 7:266-274
Shibuya N., Nishiyama T., Kanamori Y., Saito H., Nakashima N. (2003) Conditional Rather than Absolute Requirements of the Capsid Coding Sequence for Initiation of Methionine-Independent Translation in Plautia stali Intestine Virus. J. Virol. 77(22):12002-12010
Nishiyama T., Yamamoto H., Shibuya N., Hatakeyama Y., Hachimori A., Uchiumi T., Nakashima N. (2003) Structural elements in the internal ribosome entry site of Plautia stali intestine virus responsible for binding with ribosomes. Nucleic Acids Res. 31(9):2434-2442
Nishiyama T, Yamamoto H, Uchiumi T, Nakashima N (2007) Eukaryotic ribosomal protein RPS25 interacts with the conserved loop region in a dicistroviral intergenic internal ribosome entry site. Nucleic Acids Res. 5(35):1514-1521
Pfingsten JS, Costantino DA, Kieft JS (2006) Structural basis for ribosome recruitment and manipulation by a viral IRES RNA. Science. 314(5804):1450-1454
RNA:protein interactions:
The RNA:protein interaction:
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
Abbreviated name of the protein interacting with the RNA:
RPS25
Full name of the protein interacting with the RNA:
ribosomal protein 25
The description of the protein interacting with the RNA:
ribosomal protein 25
The interacting RNA base range: 6089-6090
The organism where this RNA:protein interaction occurs:
Drosophila melanogaster Canton-S
Citations:
Nishiyama T, Yamamoto H, Uchiumi T, Nakashima N (2007) Eukaryotic ribosomal protein RPS25 interacts with the conserved loop region in a dicistroviral intergenic internal ribosome entry site. Nucleic Acids Res. 5(35):1514-1521
Regions with experimentally determined secondary structures:
A region with the experimentally determined secondary structure:
IRESite 2D Struct Id: 5
Version: 2 Last change: 2006-08-07 00:00:00
Originaly submitted by: Zuzana Feketová Reviewed by: Martin Mokrejš
The function of the 2D structure:
IRES
The 2D structure causes frameshift:
no
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents):
6005-6192
The underlying nucleic acid sequence and structure of the mapped region:



Remarks:
IRES structure was mapped by mutagenesis studies which were verified by RNA structure probing using DMS, CMCT
(1-cyclohexyl-3-(2-morpholinoethyl)carbodiimide metho-p-toluene sulfonate) or by hydroxyl radical
modification. The last method was performed at 0oC.

There are three pseudoknots in this IRES element:
1. PK I is formed by base pairing between nts 6163-6167 and 6188-6192
2. PK II is formed by base pairing between nts 6039-6043 and 6142-6146
3. PK III is formed by base pairing between nts 6078-6082 and 6110-6114
4.1.1. Chemicals used to characterize at least partially the 2D structure.
Chemical reagent used with its respective buffer:
ss_experiment_with_chemical_id: 11
The temperature (in degrees of Celsia):
20
The chemical reagent used to determine the 2D structure:
DMS
Chemical reagent used with its respective buffer:
Version: 0
pH
7.20
Li+ [mM]
0
Na+ [mM]
0
K+ [mM]
150.00
Mg2+ [mM]
2.00
Ca2+ [mM]
0
Cl- [mM]
100.00
Tris [mM]
0
BSA [mM]
0
HEPES [mM]
0
EGTA [mM]
0
EDTA [mM]
0
cacodylate [mM]
50.00
Other buffer components and their relative concentrations:
40 mM DMS
Chemical reagent used with its respective buffer:
ss_experiment_with_chemical_id: 12
The temperature (in degrees of Celsia):
20
The chemical reagent used to determine the 2D structure:
CMCT
Chemical reagent used with its respective buffer:
Version: 0
pH
7.40
Li+ [mM]
0
Na+ [mM]
0
K+ [mM]
100.00
Mg2+ [mM]
2.00
Ca2+ [mM]
0
Cl- [mM]
100.00
Tris [mM]
0
BSA [mM]
0
HEPES [mM]
0
EGTA [mM]
0
EDTA [mM]
0
cacodylate [mM]
0
Other buffer components and their relative concentrations:
50 mM sodium borate
20 mM CMCT
Citations:
Shibuya N., Nishiyama T., Kanamori Y., Saito H., Nakashima N. (2003) Conditional Rather than Absolute Requirements of the Capsid Coding Sequence for Initiation of Methionine-Independent Translation in Plautia stali Intestine Virus. J. Virol. 77(22):12002-12010
Nishiyama T., Yamamoto H., Shibuya N., Hatakeyama Y., Hachimori A., Uchiumi T., Nakashima N. (2003) Structural elements in the internal ribosome entry site of Plautia stali intestine virus responsible for binding with ribosomes. Nucleic Acids Res. 31(9):2434-2442
A region with the experimentally determined secondary structure:
IRESite 2D Struct Id: 42
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The function of the 2D structure:
IRES
The 2D structure causes frameshift:
unknown
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents):
225-615
The underlying nucleic acid sequence and structure of the mapped region:



Citations:
Shibuya N, Nakashima N (2006) Characterization of the 5' internal ribosome entry site of Plautia stali intestine virus. J. Gen. Virol. 12(87):3679-3686
Last change to the database: 2015-04-16 16:45:23 GMT+1