The nucleic acid data:
IRESite Id: 68 Version: 18
Originaly submitted by: Petra Sekyrová Submission date: 2005-08-18 00:00:00
Reviewed by: Martin Mokrejš Last change: 2009-03-11 21:36:26
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  our_best_guess
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  Idefix
The genetic origin of this natural mRNA/+RNA:
  viral
The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one.
4165192 
The mRNA/+RNA description: 
Genomic mRNA transcript of Drosophila melanogaster Idefix retroelement containing gag and gag-pol genes. The
env gene is translated from subgenomic mRNA which is a spliced variant of genomic RNA (thus not annotated in
IRESite). We stripped U3 on its 5'-end and U5 on its 3'-end to make it resemble genomic +RNA transcript and
annotated only gag and gag-pol ORFs.
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  guessed_as_the_sequence_was_never_published_by_authors_nor_described_in_sufficient_detail
The organism containing this mRNA with IRES segment in its genome:
Drosophila melanogaster
A promoter reported in cDNA corresponding to IRES sequence:
  no
The total number of notable open-reading frames (ORFs):
  2
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
not_tested
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
not_tested
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
not_tested
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
no_promoter_confirmed
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Drosophila melanogaster
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 3 Last change: 2006-10-20 00:00:00
Originaly submitted by: Petra Sekyrová Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
Gag
The description of the protein encoded in this ORF:
Gag protein
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  538-1476
ORF
ORF position:   2
Version: 2 Last change: 2006-10-20 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
gag-pol
The description of the protein encoded in this ORF:
gag-pol protein
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  yes
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  538-4929
Remarks:
Authors studied region between bases 32 and 552 of the putative full-length viral +RNA transcript, spanning
right half of the R segment, further covering U5 region and complete UTR region (414b long 5'-UTR, immediately
downstream from LTR) with first 15b of gag (bases 1009-1023 of GI:4165192, including the initiator AUG).
Please note the encapsidation signal is within the gag region. Data about the position of LTR and CDS from
GenBank (GI:4165192) are different to those used by authors. The exact positions of U3-R-U5-UTR regions were
communicated with C. Vaury. The env protein is translated from a subgenomic mRNA which is a spliced variant of
the transcript lacking the IRES region and thus it is not annotated here (not in our scope). Possibility for a
cryptic promoter presence in the tested sequence was ruled out in transgenic Drosophila using UAS-GFP-Id-LacZ
plasmid. Actin-Gal4 was introduced into Drosophila flies by crossing and activated the expression from
UAS-GFP-Id-LacZ plasmid. But, IRES was not active in embryonic tissues and other cases. In any case, splicing
was not studied. From the mRNA sequence in GenBank we have manually removed 'CA' bases as the size of gag ORF
could not be divided by 3. The bases 'CA' were determined by alignment to GI:56411837 as returned by BLAST
search:



>gi|56411837|ref|NT_037436.2|Download subject sequence spanning the HSP Drosophila melanogaster chromosome 3L
Length=23771897  Score = 1661 bits (838), Expect = 0.0 Identities = 916/941 (97%), Gaps = 2/941 (0%)
Strand=Plus/Minus [...]

Query        361 GAAACACAATACTGGATTATGTTCGATAAGTTAGAATTAGAAAGTGACCATGTTGATAAA 420
                 ||||||  ||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct  20274316  GAAACA--ATACTGGATTATGTTTGATAAGTTAGAATTAGAAAGTGACCCTGTTGATAAA 20274259
Citations:
Meignin C., Bailly J. L., Arnaud F., Dastugue B., Vaury C. (2003) The 5' untranslated region and Gag product of Idefix, a long terminal repeat-retrotransposon from Drosophila melanogaster, act together to initiate a switch between translated and untranslated states of the genomic mRNA. Mol. Cell. Biol. 23(22):8246-8254
Conte C., Dastugue B., Vaury C. (2002) Coupling of enhancer and insulator properties identified in two retrotransposons modulates their mutagenic impact on nearby genes. Mol. Cell. Biol. 22(6):1767-1777
IRESs:
IRES:
Version: 14 Last change: 2008-06-26 01:00:51
Originaly submitted by: Petra Sekyrová Reviewed by: Martin Mokrejš
The IRES name:
  idefix
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  33-553
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
Authors conclude that the 5'UTR and the Gag product of an endogenous retrovirus Idefix from an insect may act
together to initiate the switch between translated and untranslated stage of the genomic +RNA, which will
ultimately be encapsidated.

According to the article the function of 414b long 5'UTR of Idefix IRES (actually 552nt cloned covering partly
R and U5 as well) was experimentally studied using bicistronic constructs both in vitro (rabbit reticulocyte
lysate, wheat germ lysate, translation of T7 synthesized capped transcripts at 30 oC, 90 min) and in
vivo in transgenic Drosophila.

Please refer also to sequences 1 and 2 from Patent WO0222839.
Citations:
Meignin C., Bailly J. L., Arnaud F., Dastugue B., Vaury C. (2003) The 5' untranslated region and Gag product of Idefix, a long terminal repeat-retrotransposon from Drosophila melanogaster, act together to initiate a switch between translated and untranslated states of the genomic mRNA. Mol. Cell. Biol. 23(22):8246-8254
RNA:protein interactions:
The RNA:protein interaction:
Version: 4 Last change: 2007-01-12 00:00:00
Originaly submitted by: Petra Sekyrová Reviewed by: Martin Mokrejš
The description of the protein interacting with the RNA:
Gag protein encoded by Idefix LTR retroelement
The function of the protein interaction:
Gag blocks IRES function
The organism where this RNA:protein interaction occurs:
Drosophila melanogaster
Remarks:
Gag-GST fusion protein was used in a TnT (TnT Qauick coupled kit, Promega) experiment performed on plasmids
bearing EMCV (encephalomyocarditis virus) IRES and Idefix IRES respectively. Addition of 280 ng of Gag-GST
decreased translation from Idefix IRES to 42% of the control (Idefix IRES without Gag-GST supplement). No
inhibition of translation was observed with EMCV IRES + Gag-GST. Thus, Gag encoded by Idefix acts as a
trans-regulating factor that is able to repress translation initiation from the 5'UTR of Idefix.
Last change to the database: 2015-04-16 16:45:23 GMT+1