The nucleic acid data:
IRESite Id: 69 Version: 18
Originaly submitted by: Petra Sekyrová Submission date: 2005-10-04 00:00:00
Reviewed by: Martin Mokrejš Last change: 2009-03-11 21:43:46
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  3UTR_incomplete
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  Gypsy
The genetic origin of this natural mRNA/+RNA:
  viral
The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one.
2801515 
The mRNA/+RNA description: 
Drosophila melanogaster gypsy LTR-transposable element, full-lenght RNA (thus missing U3 with possibly part of
R segments on its 5'-end and similarly lack U5 after the transcription termination site on its 3'-end).
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  guessed_as_the_sequence_was_never_published_by_authors_nor_described_in_sufficient_detail
The organism containing this mRNA with IRES segment in its genome:
Drosophila melanogaster
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The total number of notable open-reading frames (ORFs):
  2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 7 Last change: 2006-08-07 00:00:00
Originaly submitted by: Petra Sekyrová Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
gag
The description of the protein encoded in this ORF:
gag
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  842-2197
ORF
ORF position:   2
Version: 1 Last change: 2006-08-07 00:00:00
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
gag-pol
The description of the protein encoded in this ORF:
gag-pol protein
The translational frameshift (ribosome slippage) involved:
  +2
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  842-5232
Remarks:
The GI:2801515 sequence represents genomic +RNA of the LTR retroelement gypsy. This genomic RNA serves as a
template for gag (843-2198) gag-pol ORF (843-5233) translation of the GI:2801515. During the gag-pol
translation a ribosomal slippage is involved. The gag protein is translated from 843-2198, then the ribosome
slides +2 nt (AG 2199-2200) and continues from ATG 2201.

The gene env is translated with frameshift +1 from subgenomic spliced variant (coding sequence
join(330..331,5314..6763)) of the GI:2801515 (which has complete LTR so it does not correspong the the mRNA
transcript).


From annotation of X78389 it can be deduced the transcription start site should be after
CTTAGTTTTCAATATTGTCTTCTACTC sequence. Thus, the sequence GI:2801515 is a sequence of mRNA transcript with
complete 5'-end and that is why we based on it our annotation.

A list of various gypsy sequences follows:
gi|467632|emb|Z31368.1
gi|157583|gb|M12927.1
gi|340880|gb|M23335.1
gi|535597|gb|M23337.1
gi|2801515|gb|AF033821.1
gi|8036|emb|X03734.1
gi|157580|gb|K01957.1
gi|158636|gb|K03144.1
gi|158633|gb|K03142.1
gi|8212|emb|X00529.1
gi|158635|gb|K03143.1
gi|157850|gb|M54880.1
gi|483721|emb|X78389.1
gi|157579|gb|K01956.1
gi|157584|gb|M63280.1
gi|157573|gb|K01952.1
gi|157576|gb|K01954.1
gi|157574|gb|K01953.1
gi|157577|gb|K01955.1
gi|158617|gb|M38656.1



For more details visit http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=rv.section.8093 and
http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=rv.table.7789.


For FlyBase annotation of the various gypsy elements see
http://flybase.bio.indiana.edu/.bin/fbidq.html?FBgn0001167&content=full-report.

Authors obtained 5'UTR sequence by PCR amplification of the complete gypsy clone accession No. flybase:M12927,
which is the same as GenBank accession M12927 alias version number GI:157583. DNA sequence GI:157583 published
on 21-JUL-1995 (size 7469 bp) differs on both ends from GI:2801515 published on 17-FEB-2004 (size 7469 bp).
However, authors refer to AUG330 codon, which is not present in GI:157583 but instead in GI:2801515. Also
protein coding regions are better annotated in GI:2801515, thus, another reason to base our annotation on
this record.

The original paper does not describe the PCR primers used so it is not possible to verify whether one could
obtain GI:2801515 by the same approach. Authors studied these isolated parts of the 5'UTR regions: 1-846 in
plasmid construct pDC-WT, 330-846 in pDC-delta1, 530-846 in pDC-delta2, 664-790 in pDC-delta3, 769-790 in
pDC-delta4, 768-846 in pDC-delta5. Bicistronic mRNA (capped and uncapped) were tested in rabbit reticulocyte
lysates. Human 293T cells expressing polioviral 2A protease were transiently transfected with these plasmids
to produce monocistronic messages.
Citations:
Ronfort C., De Breyne S., Sandrin V., Darlix J. L., Ohlmann T. (2004) Characterization of two distinct RNA domains that regulate translation of the Drosophila gypsy retroelement. RNA. 10(3):504-515
Gabus C., Ivanyi-Nagy R., Depollier J., Bucheton A., Pelisson A., Darlix J. L. (2006) Characterization of a nucleocapsid-like region and of two distinct primer tRNALys,2 binding sites in the endogenous retrovirus Gypsy. Nucleic. Acids. Res. 34(20):5764-5777
IRESs:
IRES:
Version: 8 Last change: 2008-07-07 08:18:12
Originaly submitted by: Petra Sekyrová Reviewed by: Martin Mokrejš
The IRES name:
  gypsy_env
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1-330
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Citations:
Ronfort C., De Breyne S., Sandrin V., Darlix J. L., Ohlmann T. (2004) Characterization of two distinct RNA domains that regulate translation of the Drosophila gypsy retroelement. RNA. 10(3):504-515
IRES:
Version: 12 Last change: 2008-07-07 13:17:37
Originaly submitted by: Petra Sekyrová Reviewed by: Martin Mokrejš
The IRES name:
  gypsyD5
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  530-790
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
Confirmed only in rabbit reticulocyte lysate translation system; in cell cultures (human 293 T cells,
Drosophila SL2 cells,HeLa cells, CHO cells) was translation insufficient and moreover, segment dmgypsyD1
(330-846) even inhibited the translation.
Citations:
Ronfort C., De Breyne S., Sandrin V., Darlix J. L., Ohlmann T. (2004) Characterization of two distinct RNA domains that regulate translation of the Drosophila gypsy retroelement. RNA. 10(3):504-515
IRES:
Version: 11 Last change: 2008-07-07 13:17:37
Originaly submitted by: Petra Sekyrová Reviewed by: Martin Mokrejš
The IRES name:
  gypsyD2
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  330-846
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
The gypsy retroelement seems to contain two IRES sites: dmgypsy_env somewhere in the first 330 nt, dmgypsyD5
within 530-790 nt. The region denoted as dmgypsyD1 in the paper (330-846) harbors RNA sequence which
inhibits translation in human 293T cells and Drosophila SL2 cells.
Citations:
Ronfort C., De Breyne S., Sandrin V., Darlix J. L., Ohlmann T. (2004) Characterization of two distinct RNA domains that regulate translation of the Drosophila gypsy retroelement. RNA. 10(3):504-515
Last change to the database: 2015-04-16 16:45:23 GMT+1