The nucleic acid data:
IRESite Id: 71 Version: 10
Originaly submitted by: Petra Sekyrová Submission date: 2006-01-12 00:00:00
Reviewed by: Martin Mokrejš Last change: 2007-09-09 00:00:00
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear
The quality of the mRNA/+RNA sequence:
  hopefully_full-length_mRNA
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  Antp
The genetic origin of this natural mRNA/+RNA:
  nuclear
The GenBankId GI:# number of exactly this mRNA/+RNA sequence:
45553280
Synonyms of the gene name:
Synonym: Hu
Synonym: Ns
Synonym: 3.4
Synonym: Ant
Synonym: Scx
Synonym: ANTC
Synonym: AntP
Synonym: ANT-C
Synonym: ANT-P
Synonym: Antp1
Synonym: CG1028
Synonym: DmAntp
Synonym: DMANTPE1
Synonym: l(3)84Ba
Synonym: DRO15DC96Z
Synonym: BG:DS07700.1
Synonym: Sex comb extra
The mRNA/+RNA description: 
Drosophila melanogaster CG1028-PJ, isoform J (Antp) mRNA from exons CDEFGH, 3.5kb transcript
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_reverse_engineered_and_should_match_experiment
The organism containing this mRNA with IRES segment in its genome:
Drosophila melanogaster
A promoter reported in cDNA corresponding to IRES sequence:
  not tested
The total number of notable open-reading frames (ORFs):
  1
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
unclear_result
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
not_tested
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
not_tested
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Drosophila melanogaster
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
not_tested
Integrity (uniformity) of mRNA tested using RNase protection:
heterogeneous_population_of_molecules_found
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
not_tested
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
not_tested
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Drosophila melanogaster SL2
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 5 Last change: 2007-09-09 00:00:00
Originaly submitted by: Petra Sekyrová Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
Antp
The description of the protein encoded in this ORF:
CG1028-PJ, isoform J, antennapedia is a sequence-specific transcription factor which is part of a developmental regulatory system that regulates segmental identity in the mesothorax. Provides cells with specific positional identities on the anterior-posterior axis. (www.expasy.org)
The translational frameshift (ribosome slippage) involved:
  0
The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  1731-2867
Remarks:
Embryonic, larval, and pupal Antp RNA products of 3.5 and 5kb can be detected. Antennapedia is transcribed
from two promoters (P1 and P2) but at least it was not clear in the past whether the protein is produced from
P2 transcript (Laughon et al., (1986)). GI:156946 was not studied by IRESite curator in detail yet.

The transcript from the P1 promoter has 1512nt long 5'-UTR derived from non-coding exons A (55nt), B(88nt),
D(252nt), E (621 out of 777nt are coding) and from coding exons F(39nt), G(226nt), H(819nt; note the
difference to the H exon of P2 variant below). P1 transcripts are of 3.4 and 4.9kb and appear slightly later
than the exon C transcripts (from promoter P2). The 4.9-kb RNA is more abundant than the 3.4-kb species in
embryos. Antp transcripts are also found in third-instar larvae and in pupae at about 1/10 of the embryonic
levels (Laughon et al., (1986) Fig. 2A). [Laughon et al., (1986)]

P1 related GenBank records:

complete P1 mRNA record GI:156948, 4694nt long, CDS[1526-2662]

DNA record GI:156941:
  exon A ([3000-3054], 55nt)

DNA record GI:158405:
  exon A ([5216-5270], 55nt)

DNA record GI:156942:
  exon B ([625-712], 88nt)

DNA record GI:156944:
  exon D ([15-266], 252nt),
  exon E ([419-1195], 777nt; CDS[575-1195], 621nt),
  exon F ([1575-1613], 39nt),
  exon G ([1747-1972], 226nt)

DNA record GI:156945:
  exon H ([316-1382], 1067nt; CDS[316-566], 251nt; 3'-UTR 817nt)



The P2 transcript (GI:45553280) has 1727-nt long 5'-UTR derived from non-coding exons C (1321nt), D (252nt),
E(621 out of 777nt are coding) and from coding exons exons F(39nt), G(226nt), H(729nt; note the H exon differs
from the P1 variant above). P2 transcripts are 3.6 and 5.1kb; exon C-specific transcripts are first apparent
in 0 to 4h staged embryos, the 3.6-kb RNA is more abundant than the 5.1-kb species at 4 to 8 h (Laughon et
al., (1986) Fig. 2A). [Laughon et al., (1986)]

P2 related GenBank records:

incomplete P2 mRNA record GI:156950, 4419nt long, CDS[1251-2387], 480nt lacking from the very beginning of
5'-UTR from exon C

DNA record GI:156943
  exon C ([621-1939], 1319nt); possibly should be 619-1939 to result in exactly same exon sequence as
                               GI:158406[2532-3852] below to yield 1321nt
DNA record GI:158406
  exon C ([2532-3852], 1321nt)

exons D, E, F, G same as P1 transcript

DNA record GI:156945:
  exon H ([316-1294], 979nt; CDS[316-566], 251nt; 3'-UTR 729nt)



The exons A, B and C contain a number of "upstream" AUG codons followed by short ORFs which should impair
cap-dependent translation (i.e. both P1 and P2 transcripts). The authentic initiator AUG codon is placed
in exon E shared by both transcripts.


Oh et al. (1992) and later Ye et al. (1997) studied the 5'-UTR of P2 transcript consisting of exons
C(1321nt), D(252nt), E(777nt), F(39nt), G(226nt), H(729nt). The splicing variant J contains whole sequence of
all examined non-coding exons (C, D, E) bearing the putative IRES, matches the 3.4kb size and therefore
IRESite annotation is based on that mRNA sequence.

Antennapedia sequences in RefSeq as of now:
NM_206444.1 transcript variant K, exons C, D, E, G, H
NM_206445.1 transcript variant J, exons C, D, E, F, G, H, 3490nt
NM_206446.1 transcript variant I, exons A, B, D, E, F, G, H
NM_206447.1 transcript variant F, exons C, D, E, G, H
NM_206448.1 transcript variant L, exons C, D, E, F, G, H, 4902nt
NM_206449.1 transcript variant N, exons A, B, D, E, F, G, H
NM_206450.1 transcript variant E, exons A, B, D, E, G, H
NM_206451.1 transcript variant G, exons A, B, D, E, G, H
NM_206452.1 transcript variant D, exons C, D, E, F, G, H, 4890nt
NM_206453.1 transcript variant M, exons A, B, D, E, F, G, H
NM_206454.1 transcript variant H, exons C, D, E, F, G

The three alternatively spliced P2 transcription variants differ except the 3'-end at the
end of exon G, where the NM_206452 has shortened exon G:

NM_206445       atccctggatgcgaagtcagtttggtaagtgtcaagaacgcaaacgcggaaggcagacat
NM_206452       atccctggatgcgaagtcagtttg------------aacgcaaacgcggaaggcagacat
NM_206448       atccctggatgcgaagtcagtttggtaagtgtcaagaacgcaaacgcggaaggcagacat
                ***********************            *************************

The variants NM_206452 and NM_206448 have otherwise exactly same 3'-ends,
the NM_206445 variant has much shorter 3'-UTR.



Ye et al. (1997) studied functionality of IRES in Drosophila flies and stated: However, the
embryonic central nervous system and larval imaginal tissues, two major sites of Ubx and Antp expression (8,
40), did not exhibit Antp and Ubx IRES activity in our assays despite high levels of dicistronic mRNAs in
these tissues. Further worrisome are the results showing that a minor transcript is produced in flies from
the empty parental dicistronic vector as well as from its derivatives containing 5'-UTR of Ubx (Figure 5). In
summary, at least in some developmental stages IRES presence was NOT proved although mRNA was present which is
explained as a developmentally regulated IRES activity. On the other hand this shows there is either no
cryptic promoter in the putative IRES or at least is tissue specific (Ye et al. (1997), Table 3).
Citations:
Oh S. K., Scott M. P., Sarnow P. (1992) Homeotic gene Antennapedia mRNA contains 5'-noncoding sequences that confer translational initiation by internal ribosome binding. Genes. Dev. 6(9):1643-1653
Laughon A., Boulet A. M., Bermingham JR J. r., Laymon R. A., Scott M. P. (1986) Structure of transcripts from the homeotic Antennapedia gene of Drosophila melanogaster: two promoters control the major protein-coding region. Mol. Cell. Biol. 6(12):4676-4689
IRESs:
IRES:
Version: 7 Last change: 2007-09-09 00:00:00
Originaly submitted by: Petra Sekyrová Reviewed by: Martin Mokrejš
The IRES name:
  Antp-D
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1323-1574
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
Integrity of transcripts with D or CDE regions was not studied. The studies focused only on DE region in this
regard.
Citations:
Oh S. K., Scott M. P., Sarnow P. (1992) Homeotic gene Antennapedia mRNA contains 5'-noncoding sequences that confer translational initiation by internal ribosome binding. Genes. Dev. 6(9):1643-1653
IRES:
Version: 9 Last change: 2008-07-09 12:18:05
Originaly submitted by: Petra Sekyrová Reviewed by: Martin Mokrejš
The IRES name:
  Antp-DE
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1323-1730
Conclusion:
  weakly_supported_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
Drosophila SL2 cells were used to express from SV40 promoter dicistronic mRNAs with CDE, DE, DE(rev),
DE (with na extra in-frame AUG). The DE segment had 30% activity of the complete CDE segment. The
CDE segment had 240x higher activity of the negative control containing DE in inverted orientation.
[Oh et al. (1992), Table 1]

Integrity of the dicistronic transcripts was studied only for pSV40/CAT/exonDE/LUC transcript
of length around 3700bp isolated by oligo(dT). Results of RNase protection were shown in Fig. 4B, lane 4
from SL2 cells transfected by plasmid DNA; in Fig. 4C, lane 3 COS cells were transfected by plasmid DNA
with an additional band probably caused by probe being cleaved in the internal AU-rich region of CAT
within its C-terminal 140bp; in Fig. 4C, lane 5 from SL2 cells directly transfected by RNA again with
the additional band. Authors refer to Macejak and Sarnow (1991) Nature 353:90-94 for further details
about the AU-rich cleavage region. [Oh et al. (1992)]

Northern blot of mono- and polysomal fractions from COS cells was shown in Fig. 5B. CAT expressed from
the first cistron was used to correct for transfection efficiency because it was found to be similar for
all transformants. It has been proposed the DE region is sufficient to drive internal initiation.
[Oh et al. (1992), Table 1]

To confirm the results were not caused by cryptic promoter or splicing issues T7 bicistronic capped and
poly(A)-tailed mRNA transcripts were directly transfected into Drosophila SL2 cells. The D region IRES
activity was about 20x above the negative control DE with an extra AUG codon, DE IRES activity was about 40x
and activity of CDE was 94x higher. It is not clear what was the efficiency of GpppG capping and what was the
contribution of capped or uncapped while degraded RNA to the observed protein yields. It was not shown that no
shorter RNAs were present in the system by RNase protection of the in vitro transcripts except the case of
pT7/CAT/exonDE/LUC isolated by oligo(dT) from Drosophila SL2 cells (Fig. 4C, lane 5).
In contrast, uncapped RNA with CDE IRES was at about 85% of the LUC activity of the capped RNA while
CAT activity dropped to 13%. [Oh et al. (1992), Table 2]

RNase protection assay of oligo(dT) selected RNA was utilized to show no shorter mRNAs were present in
plasmid-based transfections (only the combination of DE exons tested in COS and Drosophila SL2 cells). A
shorter mRNA was confirmed as a result of RNase cleavage in AU-rich region of CAT. The 771nt probe covered the
intercistronic region of 450nt (non-coding regions of DE spans 409nt).
Further, in vitro T7 transcripts were gel-purified and transfected into the Drosophila SL2 cells and again,
RNase protection of these oligo(dT) selected RNAs confirmed that at least some bicistronic mRNA was intact
even 19hrs post-transfection. [Oh et al. (1992), Fig. 4]

Utilization of COS cells transiently transfected by the plasmid containing DE exons and a hairpin in front of
CAT exon and 48hrs post-transfection infected by poliovirus showed that the dicistronic hairpinCAT/exonDE/LUC
mRNA remained in polysomal fraction after poliovirus infection despite the fact the mRNAs contained the
hairpin which should block ribosome scanning (4 hrs post-infection ribosomes were arrested by cycloheximide
and RNA purified by oligo(dT)). [Oh et al. (1992), Fig. 5]


The activity of this part of Antp 5'-UTR (pACA2B construct) was not convincingly confirmed by Ye et al.
(1997) and the observed IRES activity could be due to a promoter or splicing issue.
Citations:
Oh S. K., Scott M. P., Sarnow P. (1992) Homeotic gene Antennapedia mRNA contains 5'-noncoding sequences that confer translational initiation by internal ribosome binding. Genes. Dev. 6(9):1643-1653
Ye X., Fong P., Iizuka N., Choate D., Cavener D. R. (1997) Ultrabithorax and Antennapedia 5' untranslated regions promote developmentally regulated internal translation initiation. Mol. Cell. Biol. 17(3):1714-1721
IRES:
Version: 12 Last change: 2008-07-09 12:18:05
Originaly submitted by: Petra Sekyrová Reviewed by: Martin Mokrejš
The IRES name:
  Antp-CDE
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  1-1730
Conclusion:
  putative_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
The exon C contains 15 AUG codons followed by very short open read frames. The activity of the complete Antp
5'-UTR (pACA1B construct) was neither convincingly confirmed by Oh et al. (1992) nor Ye et al. (1997)
and the observed IRES activity could be due to a promoter or splicing issue.
Citations:
Oh S. K., Scott M. P., Sarnow P. (1992) Homeotic gene Antennapedia mRNA contains 5'-noncoding sequences that confer translational initiation by internal ribosome binding. Genes. Dev. 6(9):1643-1653
Ye X., Fong P., Iizuka N., Choate D., Cavener D. R. (1997) Ultrabithorax and Antennapedia 5' untranslated regions promote developmentally regulated internal translation initiation. Mol. Cell. Biol. 17(3):1714-1721
Last change to the database: 2015-04-16 16:45:23 GMT+1