IRESite logo IRESite: The database of experimentally verified IRES structures RNAlab logo
User: guest
The nucleic acid data:
IRESite Id: 140 Version: 11
Originaly submitted by: Martin Mokrejš
Reviewed by: Martin Mokrejš Last change: 2009-09-03 13:29:04
IRESite record type:
  natural_transcript
The shape of the nucleic acid molecule translated:
  linear 		The quality of the mRNA/+RNA sequence:
  end-to-end_full-length_mRNA
The abbreviated name of the virus/gene coding for this mRNA/+RNA molecule:
  EMCV-R 		The genetic origin of this natural mRNA/+RNA:
  viral
The GenBankId GI:# number of the most similar mRNA/+RNA sequence to this one.
9626692 
The mRNA/+RNA description:  
Encephalomyocarditis virus, complete genome
The mRNA/+RNA sequence represented in the +DNA notation:


Credibility of mRNA sequence:
  end-to-end_sequence_completely_same_as_in_the_experiment
The organism containing this mRNA with IRES segment in its genome:
Encephalomyocarditis virus Rueckert
A promoter reported in cDNA corresponding to IRES sequence:
  no 		The total number of notable open-reading frames (ORFs):
  1
Summary of possible issues when IRES cDNA is experimentally transcribed in vivo:
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
homogeneous_population_of_molecules_confirmed
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
not_tested
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
no_promoter_confirmed
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Cercopithecus aethiops COS-7 (ATCC CRL-1651)
Summary of experiments studying integrity of the in vivo transcripts in a particular host:
Integrity (uniformity) of mRNA tested using Northern-blot:
not_tested
Integrity (uniformity) of mRNA tested using RNase protection:
not_tested
Integrity (uniformity) of mRNA tested using 5'-RACE:
not_tested
Integrity (uniformity) of mRNA tested using primer extension :
not_tested
Integrity (uniformity) of mRNA tested using RT-PCR:
not_tested
Integrity (uniformity) of mRNA tested using real-time quantitative polymerase chain reaction (rtqPCR):
not_tested
Integrity (uniformity) of mRNA tested using RNAi:
not_tested
Integrity (uniformity) of mRNA tested using S1 nuclease mapping:
not_tested
Cryptic promoter presence was confirmed by expression from a promoter-less plasmid:
no_promoter_confirmed
Cryptic promoter presence was confirmed in an experimental setup involving inducible promoter:
not_tested
Integrity (uniformity) of mRNA molecules or possible promoter presence expressed in vivo was tested using another method, please specify in Remarks:
not_tested
The organism used:
Homo sapiens
Notable Open-Reading Frames (ORFs; protein coding regions) in the mRNA/+RNA sequence:
ORF
ORF position:   1
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The abbreviated name of this ORF/gene:
polyprotein
The description of the protein encoded in this ORF:
genomic polyprotein
The translational frameshift (ribosome slippage) involved:
  0 		The ribosome read-through involved:
  no
The alternative forms of this protein occur by the alternative initiation of translation:
  no
The ORF absolute position (the base range includes START and STOP codons or their equivalents):
  834-7712
Remarks:
The initial studies of EMCV IRES were based on the pMPS1-based bicistronic plasmids containing viral sea
oncogene and polioviral 2A gene (Jang et al., 1988).

Almost no luciferase activity could be measured in cells transfected with promoter-less bicistronic
constructs. Further, no shorter luciferase containing transcripts could be detected on Northern-blots. The
sequence of the EMCV-R IRES is available in a GenBank record GI:9626692 (NC_001479 having exactly same
sequence as the original Rueckert strain in M81861 record described by Palmenberg).


At some point EMCV IRES used in labs acquired a point mutation/insertion causing high dependence on PTB
protein (Kaminski and Jackson, 1998). Note the 7 'a' instead of just 6.

mutated: 482 cacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacgg 541
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
     wt: 740 cacatgctttacatgtgtttagtcgaggtt-aaaaaacgtctaggccccccgaaccacgg 798


The disctinction between EMCV-R, EMCV-B, EMCV-D and mengovirus-M in their poly(C) tracts is e.g. shown in Duke
et al. (1992), Fig. 2.


Bet et al. (2006) and Young et al. (2008) used EMCV IRES a a positive in their experiments and therefore
tested whether the IRES contains promoter activity in HeLa and NIH3T3 cells, respectively. They did not
confirm one.
Citations:
Wang Z., Weaver M., Magnuson N. S. (2005) Cryptic promoter activity in the DNA sequence corresponding to the pim-1 5'-UTR. Nucleic Acids Res. 33(7):2248-2258
Duke G. M., Hoffman M. A., Palmenberg A. C. (1992) Sequence and structural elements that contribute to efficient encephalomyocarditis virus RNA translation. J. Virol. 66(3):1602-1609
Kaminski A., Jackson R. J. (1998) The polypyrimidine tract binding protein (PTB) requirement for internal initiation of translation of cardiovirus RNAs is conditional rather than absolute. RNA. 4(6):626-638
Jang S. K., Krausslich H. G., Nicklin M. J., Duke G. M., Palmenberg A. C., Wimmer E. (1988) A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. J. Virol. 62(8):2636-2643
Young RM, Wang SJ, Gordan JD, Ji X, Liebhaber SA, Simon MC (2008) Hypoxia-mediated selective mRNA translation by an internal ribosome entry site-independent mechanism. J. Biol. Chem. 283(24):16309-16319
Bert AG, Grépin R, Vadas MA, Goodall GJ (2006) Assessing IRES activity in the HIF-1alpha and other cellular 5' UTRs. RNA. 12(6):1074-1083
IRESs:
IRES:
Version: 10 Last change: 2008-12-20 17:30:47
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The IRES name:
  EMCV-R
The IRES absolute position (the range includes START and STOP codons or their equivalents):
  257-832
Conclusion:
  strongly_supported_IRES
How IRES boundaries were determined:
experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):


Remarks:
The sequence tested had IRES activity in many in vivo and in vitro experiments including direct
RNA transfections. Efficiency of EMCV IRES-based commercially available vectors was discussed by Bochkov and
Palmenberg, 2006.


At some point EMCV IRES used in labs acquired a point mutation/insertion causing high dependence on PTB
protein (Kaminski and Jackson, 1998). Note the 7 'a' instead of just 6.

mutated: 482 cacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacgg 541
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
     wt: 740 cacatgctttacatgtgtttagtcgaggtt-aaaaaacgtctaggccccccgaaccacgg 798

Heterogeneous nuclear ribonucleoprotein (hnRNP) A1 was not found to bind to EMCV IRES (Cammas et al., 2007)
which binds to HRV-2 and Apaf-1 IRESs.

EMCV IRES does not require Unr protein for its activity (Boussadia et al., 2003).

EMCV IRES does not require ITAF45 protein for its activity (Pilipenko et al., 2000).
Citations:
Wang Z., Weaver M., Magnuson N. S. (2005) Cryptic promoter activity in the DNA sequence corresponding to the pim-1 5'-UTR. Nucleic Acids Res. 33(7):2248-2258
Cammas A., Pileur F., Bonnal S., Lewis S. M., Leveque N., Holcik M., Vagner S. (2007) Cytoplasmic relocalization of heterogeneous nuclear ribonucleoprotein A1 controls translation initiation of specific mRNAs. Mol. Biol. Cell. 18(12):5048-5059
Boussadia O., Niepmann M., Creancier L., Prats A. C., Dautry F., Jacquemin-Sablon H. (2003) Unr is required in vivo for efficient initiation of translation from the internal ribosome entry sites of both rhinovirus and poliovirus. J. Virol. 77(6):3353-3359
Pilipenko E. V., Pestova T. V., Kolupaeva V. G., Khitrina E. V., Poperechnaya A. N., Agol V. I., Hellen C. U. (2000) A cell cycle-dependent protein serves as a template-specific translation initiation factor. Genes. Dev. 14(16):2028-2045
Kaminski A., Jackson R. J. (1998) The polypyrimidine tract binding protein (PTB) requirement for internal initiation of translation of cardiovirus RNAs is conditional rather than absolute. RNA. 4(6):626-638
Bochkov Y. A., Palmenberg A. C. (2006) Translational efficiency of EMCV IRES in bicistronic vectors is dependent upon IRES sequence and gene location. Biotechniques. 41(3):283-284, 286, 288, 290
IRES trans-acting factor (ITAFS):
IRES trans-acting factor (ITAF):
Version: 1 Last change: 2009-09-17 12:50:48
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
Type of the interaction between ITAF and the RNA subject to translation:
direct_interaction_with_rna
ITAF protein characteristics:
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
ITAF abbreviated name:
PTB
ITAF fullname:
polypyrimidine-tract binding protein (unspecified isoform)
ITAF description (long):
polypyrimidine-tract binding protein
3.1.2. Organisms or in vitro systems where this ITAF was functionally studied:
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system:
required_but_available_internally
Method used to demonstrate ITAF effect:
in_vitro 		In vitro system used to demonstrate ITAF effect:
rabbit reticulocytes lysate
Remarks:
The copies of the inadverently mutated EMCV IRES require PTB cofactor (57 kDa).
Citations:
Kaminski A., Jackson R. J. (1998) The polypyrimidine tract binding protein (PTB) requirement for internal initiation of translation of cardiovirus RNAs is conditional rather than absolute. RNA. 4(6):626-638
Kafasla P, Morgner N, Pöyry TA, Curry S, Robinson CV, Jackson RJ (2009) Polypyrimidine tract binding protein stabilizes the encephalomyocarditis virus IRES structure via binding multiple sites in a unique orientation. Mol. Cell. 34(5):556-568
IRES trans-acting factor (ITAF):
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
Type of the interaction between ITAF and the RNA subject to translation:
direct_interaction_with_rna
ITAF protein characteristics:
Version: 0
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
ITAF abbreviated name:
hnRNP_D
ITAF fullname:
heterogeneous ribonucleoprotein D
ITAF description (long):
heterogeneous ribonucleoprotein D (AUF1) AU-rich region binding protein
3.2.2. Organisms or in vitro systems where this ITAF was functionally studied:
Organism or in vitro system where ITAF was shown:
Necessity of ITAF for translation in this particular organism or system:
no_effect_on_translation
Method used to demonstrate ITAF effect:
in_vivo
The organism where action of this ITAF was studied:
Homo sapiens HeLa (ATCC CCL-2)
Remarks:
Unlike HCV IRES the IRES of EMCV does not require hnRNP D.
Citations:
Paek KY, Kim CS, Park SM, Kim JH, Jang SK (2008) RNA-binding protein hnRNP D modulates internal ribosome entry site-dependent translation of hepatitis C virus RNA. J. Virol. 82(24):12082-12093
Regions with experimentally determined secondary structures:
A region with the experimentally determined secondary structure:

IRESite 2D Struct Id: 40
Version: 1 Last change: 2009-09-17 12:50:48
Originaly submitted by: Martin Mokrejš Reviewed by: Martin Mokrejš
The function of the 2D structure:
IRES 		The 2D structure causes frameshift:
no
The absolute position of the experimentally mapped region (the range includes START and STOP codons or their equivalents):
372-808
The underlying nucleic acid sequence and structure of the mapped region:



There is no Vienna RNA package installed on the server or some error/warning messages were output. Due to that maybe we cannot prepare 2D structures for display. The error/warning message was:
WARNING: bases 30 and 34 (GA) can't pair!

STDOUT was:
AGGGCCCGGAAACCUGGCCCUGUCUUCUUGACGAGCAUUCCUAGGGGUCUUUCCCCUCUCGCCAAAGGAAUGCAAGGUCUGUUGAAUGUCGUGAAGGAAGCAGUUCCUCUGGAAGCUUCUUGAAGACAAACAACGUCUGUAGCGACCCUUUGCAGGCAGCGGAACCCCCCACCUGGCGACAGGUGCCUCUGCGGCCAAAAGCCACGUGUAUAAGAUACACCUGCAAAGGCGGCACAACCCCAGUGCCACGUUGUGAGUUGGAUAGUUGUGGAAAGAGUCAAAUGGCUCUCCUCAAGCGUAUUCAACAAGGGGCUGAAGGAUGCCCAGAAGGUACCCCAUUGUAUGGGAUCUGAUCUGGGGCCUCGGUGCACAUGCUUUACAUGUGUUUAGUCGAGGUUAAAAAACGUCUAGGCCCCCCGAACCACGGGGACGUGGUU
((((((.((...)).)))))).....((((...)(((((((((((((.....)))))........)))))))).)))..((((((((..((...(((((((..((.((((..((....((.....((..(((((((..((....))(((((((((((((.((.......((((((....)))))))).))))(((.....)))..((((((...))))))))))))))).(((((.......))))))))))))..)).....))))......))))...))..))).))))....)).)))))))).(((((.....((((((((((((((..(((((...)))))))))..)))))).(((((...((((((.....))))))......)))))........))))...)))))...(((((((....))))))) (-138.00)

Rendering structure of EMCV-R mRNA 437 nt long with energy of -138.00 kcal/mol as calculated by RNAeval using VARNA Java applet with some IRESite improvements (see VARNA modified by IRESite). Hold left mouse button to move structure parts, hold right mouse button to move whole structure, use mouse wheel to zoom. Right mouse-click opens a menu to export into JPG/SVG and many other options.

You need a Java-enabled browser so that modified varsion of VARNA could be started. See http://www.iresite.org/VARNA/ for more details.
Remarks:
The sequence published in the article probably contains mistyped single base at position 775. It should be 'a'
instead of 'g'. Please note the Remarks above about the PTB dependency (it is just about this strecth of
adenosines).

>IRESite_Id:140 EMCV-R virus
          Length = 7835

 Score =  757 bits (433), Expect = 0.0
 Identities = 436/437 (99%)
 Strand = Plus / Plus


Query: 1   agggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 372 agggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctc 431


Query: 61  gccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttct 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 432 gccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttct 491


Query: 121 tgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgac 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 492 tgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgac 551


Query: 181 aggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 552 aggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccc 611


Query: 241 cagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgta 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 612 cagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgta 671


Query: 301 ttcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctgggg 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 672 ttcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctgggg 731


Query: 361 cctcggtgcacatgctttacatgtgtttagtcgaggttaaaaagcgtctaggccccccga 420
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 732 cctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaacgtctaggccccccga 791


Query: 421 accacggggacgtggtt 437
           |||||||||||||||||
Sbjct: 792 accacggggacgtggtt 808
4.1.1. Enzymes used to characterize at least partially the 2D structure.
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 67
The temperature (in degrees of Celsia):
37 		The enzymatic method used to determine the 2D structure:
ribonuclease V1
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH
7.50 		Li+ [mM]
0 		Na+ [mM]
0 		K+ [mM]
0 		Mg2+ [mM]
10.00 		Ca2+ [mM]
0
Cl- [mM]
220.00 		Tris [mM]
20.00 		BSA [mM]
0 		HEPES [mM]
0 		EGTA [mM]
0 		EDTA [mM]
0
cacodylate [mM]
0
Other buffer components and their relative concentrations:
200 mM NH4+
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
ss_experiment_with_enzyme_id: 68
The temperature (in degrees of Celsia):
37 		The enzymatic method used to determine the 2D structure:
S1 nuclease
Enzyme or a combination of enzymes used in a single experiment with respective buffer:
Version: 0
pH
4.70 		Li+ [mM]
0 		Na+ [mM]
90.00 		K+ [mM]
0 		Mg2+ [mM]
5.00 		Ca2+ [mM]
0
Cl- [mM]
20.00 		Tris [mM]
0 		BSA [mM]
0 		HEPES [mM]
0 		EGTA [mM]
0 		EDTA [mM]
0
cacodylate [mM]
0
Other buffer components and their relative concentrations:
2 mM Zn2+
6 mM NH4+
40 mM acetate
4.1.2. Chemicals used to characterize at least partially the 2D structure.
Chemical reagent used with its respective buffer:
ss_experiment_with_chemical_id: 29
The temperature (in degrees of Celsia):
37 		The chemical reagent used to determine the 2D structure:
DMS
Chemical reagent used with its respective buffer:
Version: 0
pH
7.00 		Li+ [mM]
0 		Na+ [mM]
100.00 		K+ [mM]
0 		Mg2+ [mM]
20.00 		Ca2+ [mM]
0
Cl- [mM]
40.00 		Tris [mM]
0 		BSA [mM]
0 		HEPES [mM]
0 		EGTA [mM]
0 		EDTA [mM]
0
cacodylate [mM]
0
Other buffer components and their relative concentrations:
100 mM cacodylate
Citations:
Pilipenko EV, Blinov VM, Chernov BK, Dmitrieva TM, Agol VI (1989) Conservation of the secondary structure elements of the 5'-untranslated region of cardio- and aphthovirus RNAs. Nucleic Acids Res. 14(17):5701-5711
Last change to the database: 2019-03-18 09:32:49 GMT+1