IRESite: Page structure

Search description

The search tool in IRESite is based on RNAforester package, currently part of Vienna RNA Package. The search is performed in the so called small-in-large mode of RNAforester. Your query structure is considered as the small one, the structures being searched within the database as the large ones. The small-in-large mode can be seen as performing global alignment of the small structure against local alignment of the large structure -- the algorithm tries to find the whole small structure within the large one.

Example of a search query

Searched structure:

>Search query AGATGGACCGGAGCAGCCCTCCAATATCT ((((.....((((.....))))...))))

Table bellow shows first three hits against IRESite database. It shows the text output of the database search and its graphical representation. The right-most hairpin is the small structure, on the left side is depicted the large structure in outline and detail view.
Black bases stand for identities, red bases within the small structure stand for gaps and gray bases in large structure are unmached regions between the two structure alignments.

Your query modified by gaps: >Search query Length = 29 Score = 93 Identities with small structure = 29/29 (100%), Gaps = 0/29 (0%) Identities with large structure = 29/29 (100%), Gaps = 0/29 (0%) Strand = Plus / Plus (Minus strand search not supported) >Search query 1 agauggaccggagcagcccuccaauaucu 30 1 ((((.....((((.....))))...)))) 30 The target hit adjusted by gaps: >IRESite_2DExp_Struct_Id:6 PSIV 102 agauggaccggagcagcccuccaauaucu 131 102 ((((.....((((.....))))...)))) 131

Score = 43 Identities with small structure = 29/31 (93%), Gaps = 2/31 (6%) Identities with large structure = 30/31 (96%), Gaps = 1/31 (3%) Strand = Plus / Plus (Minus strand search not supported) Your query modified by gaps: Length = 31 >Search query 1 agauggaccggagcagcccucc-aau-aucu 31 1 ((((.....((((.....))))-...-)))) 31 The target hit adjusted by gaps: >IRESite_Id:42 HAV 26 aaaucu-guuucucuauaagaacacucauuu 56 26 ((((..-((((((.....)))).))..)))) 56

Score = 35 Identities with small structure = 29/29 (100%), Gaps = 0/29 (0%) Identities with large structure = 27/29 (93%), Gaps = 2/29 (6%) Strand = Plus / Plus (Minus strand search not supported) Your query modified by gaps: Length = 29 >Search query 1 agauggaccggagcagcccuccaauaucu 29 1 ((((.....((((.....))))...)))) 29 The target hit adjusted by gaps: >IRESite_Id:35 c-myc 75 gcggg--cguccugggaagggagauccgg 103 75 .(((.--..(((.......)))...))). 103