IRESite record type: plasmid_with_promoter_and_putative_IRES_without_translational_characterization
The shape of the nucleic acid molecule translated: linear
The quality of the mRNA/+RNA sequence: hopefully_full-length_mRNA
The mRNA/+RNA description:
In vitro T7 transcript containing renilla_luciferase - hairpin_from_multiple_cloning_site -
CVB3_nt1-750 - 45_nt_of_FMDV_2A_protease - firefly_luciferase and terminated at XbaI site immediately after
the STOP codon. A fusion protein CVB3+FMDV+Fluc should be translated from the second cistron (N-terminal 31
additional aminoacids fused to FLuc).
The mRNA/+RNA sequence represented in the +DNA notation:
Credibility of mRNA sequence: end-to-end_sequence_reverse_engineered_and_should_match_experiment
The abbreviated name of this ORF/gene: FLuc-fusion
The description of the protein encoded in this ORF: Firefly luciferase to which is fused coding part of CVB3 IRES (atgggaGCGGCCGC) which is followed by FMDV 2A
protease fragment aattttgaccttctcaagttggcgggagacgtcgagtccaaccct and additional 34 bases of unknown origin and
then finally comes the FLuc ORF.
The translational frameshift (ribosome slippage) involved: 0
The ribosome read-through involved: no
The alternative forms of this protein occur by the alternative initiation of translation: not tested
The ORF absolute position (the base range includes START and STOP codons or their equivalents): 1774-3519
Remarks:
The plasmid with one mismatch encodes complete protease except the very last aminoacid residue fused to the
firefly-luciferase reporter protein. The cleavage protein causes release of the N-terminal
part of the protein while some ribosomes can resume protein synthesis with prolyl-tRNA.
>gi|4007043|emb|AJ007572.1|FMV7572 Foot-and-mouth disease virus, derived from C3Arg85, clone 15
Length=8161
Score = 81.8 bits (41), Expect = 1e-13
Identities = 44/45 (97%), Gaps = 0/45 (0%)
Strand=Plus/Plus
Query 1 AATTTTGACCTTCTCAAGTTGGCGGGAGACGTCGAGTCCAACCCT 45
|||||||||||||| ||||||||||||||||||||||||||||||
Sbjct 3881 AATTTTGACCTTCTTAAGTTGGCGGGAGACGTCGAGTCCAACCCT 3925
LOCUS FMV7572 8161 bp RNA linear VRL 15-APR-2005
DEFINITION Foot-and-mouth disease virus, derived from C3Arg85, clone 15.
ACCESSION AJ007572
VERSION AJ007572.1 GI:4007043
[...]
FEATURES Location/Qualifiers
source 1..8161
/organism="Foot-and-mouth disease virus"
/virion
/mol_type="genomic RNA"
/strain="C3Arg85"
/isolate="clone 15"
/db_xref="taxon:12110"
source 1..8161
/organism="Foot-and-mouth disease virus"
/virion
/mol_type="genomic RNA"
/strain="C3Arg85"
/isolate="clone 15"
/db_xref="taxon:12110"
CDS 1082..8068
/codon_start=1
/product="polyprotein"
/protein_id="CAA07561.1"
/db_xref="GI:4007044"
[...]
mat_peptide 3881..3928
/product="2A protein"