The abbreviated name of this ORF/gene: polyprotein
The description of the protein encoded in this ORF: polyprotein
The translational frameshift (ribosome slippage) involved: 0
The ribosome read-through involved: no
The alternative forms of this protein occur by the alternative initiation of translation: yes
The ORF absolute position (the base range includes START and STOP codons or their equivalents): 1210-7596
Remarks:
The genomic sequence was in silico assembled by IRESite curator as a merge of sequences provided by T. Hinton
and merged with GI:2231133 from the same lab. The sequences mostly overlap, so in summary 59bp sequence
'TTAAGCTTGTACCTGTAGCGTCAGTAAAACGCAGAAACCAAACGCAATTGCCTGTAGCG' was prepended to the original GenBank record.
According to the article by Hinton et al. (2000) they studied only the 5'-UTR region downstream the poly(C)
tract and thus their base position +1 was actually the one downstream poly(C) tract. Thus, the sequence
reconstructed here is still an incomplete genome at the 5'-end at least.
There are two AUGAUG regions: 852-857 and 915-920. Results indicate that translation predominantly occurs from
the first pair of AUG codons and that the latter 855-AUG-857 appears to be the major initiator. Translation in
ERAV also appears to initiate from the second pair of AUG codons, probably 918-AUG-920, but this occurs at
only about 1/10 of the level of initiation from 850-AUG-857. Full IRES activity requires nt 245 to 961
downstream of the poly(C) tract. Bicistronic T7 transcripts were transcribed in vivo in recombinant vaccinia
virus infected human cells BHK21.
The IRES absolute position (the range includes START and STOP codons or their equivalents): 245-956
Conclusion: strongly_supported_IRES
How IRES boundaries were determined: experimentally_determined
The sequence of IRES region aligned to its secondary structure (if available):
Remarks:
Deletion of the 5' end to nt 245 had no apparent effect on the IRES activity. A further 5' truncation to nt
338 caused a substantial decrease in the IRES activity. Truncation of the 3' end of the IRES to nt 921 also
led to reduction in IRES activity.